ID: 1172708565

View in Genome Browser
Species Human (GRCh38)
Location 20:36901985-36902007
Sequence ATACAGTGACAGATGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 523
Summary {0: 1, 1: 0, 2: 3, 3: 72, 4: 447}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172708560_1172708565 3 Left 1172708560 20:36901959-36901981 CCCCACTATAAGAATGGGAATAC 0: 1
1: 0
2: 0
3: 11
4: 143
Right 1172708565 20:36901985-36902007 ATACAGTGACAGATGGAGGAAGG 0: 1
1: 0
2: 3
3: 72
4: 447
1172708557_1172708565 27 Left 1172708557 20:36901935-36901957 CCTTTGACAAGAACAAAGCTGTT 0: 1
1: 0
2: 0
3: 11
4: 238
Right 1172708565 20:36901985-36902007 ATACAGTGACAGATGGAGGAAGG 0: 1
1: 0
2: 3
3: 72
4: 447
1172708562_1172708565 1 Left 1172708562 20:36901961-36901983 CCACTATAAGAATGGGAATACTG 0: 1
1: 0
2: 0
3: 11
4: 148
Right 1172708565 20:36901985-36902007 ATACAGTGACAGATGGAGGAAGG 0: 1
1: 0
2: 3
3: 72
4: 447
1172708561_1172708565 2 Left 1172708561 20:36901960-36901982 CCCACTATAAGAATGGGAATACT 0: 1
1: 0
2: 0
3: 13
4: 360
Right 1172708565 20:36901985-36902007 ATACAGTGACAGATGGAGGAAGG 0: 1
1: 0
2: 3
3: 72
4: 447

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172708565 Original CRISPR ATACAGTGACAGATGGAGGA AGG Intronic
901151503 1:7106233-7106255 ATACACTGAGGGAGGGAGGAAGG + Intronic
901594110 1:10371207-10371229 AGAGAGGGACAGGTGGAGGAGGG - Exonic
902173132 1:14629177-14629199 ATACGGTGGCAGGGGGAGGATGG + Intronic
902489866 1:16773440-16773462 AGACAGAGACAGAGGGAAGATGG - Intronic
902723934 1:18322928-18322950 AGCCAGTGAAAGATGGAGGGTGG + Intronic
902973341 1:20070978-20071000 AGAGAGGGAGAGATGGAGGAAGG - Intronic
905170974 1:36109327-36109349 AGACAGAGCCAGAAGGAGGAGGG - Intronic
905360425 1:37415582-37415604 ATTCTGTGACTGATGGATGAAGG - Intergenic
905803042 1:40857887-40857909 ATCCAGTGACTGATGGAGGCAGG + Intergenic
908448008 1:64220299-64220321 ATACTCTGACAGCTGGACGAGGG + Intronic
908910001 1:69062271-69062293 ACACAGAGACAGAGGGAGGCGGG + Intergenic
908912762 1:69091606-69091628 ACACAGAGACAGAGGGAGGGAGG - Intergenic
909464497 1:75958181-75958203 CTAGGGTGACAGATGGAGGCAGG + Intergenic
909791779 1:79688618-79688640 ACCCAGTGACACAAGGAGGATGG - Intergenic
909901661 1:81144654-81144676 AGACAAAGACATATGGAGGATGG - Intergenic
910265089 1:85330144-85330166 ATGCAGAGAAAGATGCAGGAAGG + Intronic
911886451 1:103306368-103306390 AGACAGTGAAACATGGTGGATGG + Intergenic
912047700 1:105480784-105480806 GTACAGAGACAGAGGGAGGGGGG - Intergenic
912609429 1:111028273-111028295 GTACAGAGACAGAAGGAGGGGGG - Intergenic
913217615 1:116633621-116633643 ATACAGAGACAGAGGGAAGGGGG - Intronic
915116458 1:153603739-153603761 ATACAGAGACAGAGGGAGGGGGG - Intergenic
915250479 1:154584779-154584801 CTCCAGTGACAGATGGATTAGGG - Exonic
915267540 1:154729627-154729649 TGAAAGTGACAAATGGAGGAGGG + Intronic
916352118 1:163862468-163862490 ATGCAGTGGCAGAGGGAGAAGGG + Intergenic
916727618 1:167536798-167536820 ATATAGTGGAAGATGGAGGTTGG - Intronic
916771434 1:167912633-167912655 ATACAGAGACAGAGGGAGGGGGG - Intronic
916801459 1:168220274-168220296 GTACAGAGACAGAGGGAGGGGGG + Intergenic
917367443 1:174247860-174247882 ATACAGAGACAGAGGGAGAGGGG - Intronic
918769775 1:188542008-188542030 ATACAGTAACAGAAAAAGGAAGG + Intergenic
919041816 1:192398549-192398571 CTACACAGAAAGATGGAGGAAGG + Intergenic
919841078 1:201609850-201609872 ATAGAGAGAGAGAGGGAGGAGGG + Intergenic
919908290 1:202093468-202093490 GTACAGAGACAGAGGGAGGGAGG + Intergenic
920002488 1:202809236-202809258 ACATAGTGACAGATTGAGGGGGG + Exonic
920061635 1:203230819-203230841 ATACAGAGACACAGCGAGGAAGG - Intronic
920288227 1:204897265-204897287 AGACAATGACAGATGGAGGGTGG + Intronic
920299460 1:204979446-204979468 ATACGGGGACAGCCGGAGGACGG - Exonic
920639763 1:207741016-207741038 TTACAGAGACAGAGGGAGGGGGG - Intergenic
922424116 1:225478138-225478160 GTTCAGTGACAGGTGGAGGGAGG + Intergenic
922550607 1:226491473-226491495 ATACAGAGACAGAGGGAGGGGGG + Intergenic
922551039 1:226494744-226494766 ATACACAGACAGAGGGAGGGGGG + Intergenic
922637164 1:227185644-227185666 CTACAGAGACAGAGGGAGGGGGG - Intronic
923397395 1:233580576-233580598 AGACAAGAACAGATGGAGGAAGG - Intergenic
923530575 1:234809088-234809110 AGACAGAGACAGAGGGAAGATGG + Intergenic
924888618 1:248248473-248248495 AGGGAGTGACAGAGGGAGGAAGG + Intergenic
1063772186 10:9216226-9216248 ATTCAATGACAGATTGATGAGGG + Intergenic
1064353417 10:14597596-14597618 ACACAGGGACACTTGGAGGATGG - Intronic
1065150293 10:22816026-22816048 ATACAGTAAGAGAGGGAAGAGGG - Intergenic
1065781402 10:29171685-29171707 ATACAGAGACAGAGGGAGGGGGG + Intergenic
1066106357 10:32160723-32160745 ATACTGGGACAGATGATGGACGG + Intergenic
1066110025 10:32187649-32187671 ATACAGAGACAGAGGGAGGGGGG + Intergenic
1066471311 10:35700879-35700901 ATACAGAGACAGAGGGAGAGGGG - Intergenic
1067051505 10:43024176-43024198 ATAGATGGACAGATGGATGATGG + Intergenic
1067969132 10:50949571-50949593 ATACCTTGACAGAATGAGGAGGG + Intergenic
1068331009 10:55568868-55568890 ATGCAGTGACAGATGCAGCGAGG - Intronic
1068332985 10:55597353-55597375 ATAAAGTCAGAGATGGAGGGAGG - Intronic
1068522458 10:58093050-58093072 ATACAAAGACAGAGGGAGGGGGG + Intergenic
1070142190 10:73746580-73746602 AGACAGTGACAAAGGGTGGATGG + Intronic
1073838485 10:107471337-107471359 GTACAGAGACAGAGGGAGGGGGG + Intergenic
1074618212 10:115092454-115092476 ATATCGTCCCAGATGGAGGAGGG + Intergenic
1074931199 10:118127939-118127961 AAGAAGTGACAGATGGAGGAAGG - Intergenic
1076362484 10:129899047-129899069 AGACAGTGACAGATGCTGAACGG - Intronic
1077280503 11:1742895-1742917 ATGGATGGACAGATGGAGGATGG + Intronic
1077280556 11:1743142-1743164 ATGGATGGACAGATGGAGGATGG + Intronic
1077280576 11:1743274-1743296 ATGGATGGACAGATGGAGGATGG + Intronic
1079805088 11:24921196-24921218 ATACAGAGACAGAGGGAGGGGGG + Intronic
1079858931 11:25643216-25643238 ATAGAGTGAGATATGGGGGAAGG - Intergenic
1080935495 11:36858563-36858585 GTACAGAGACAGAGGGAGGGGGG - Intergenic
1081112843 11:39158232-39158254 ACACAGTTACAGATGTGGGAAGG - Intergenic
1081197680 11:40181196-40181218 AGACATGGAGAGATGGAGGAAGG - Intronic
1081641274 11:44755975-44755997 ATGGAGAGAGAGATGGAGGAGGG + Intronic
1083045242 11:59728672-59728694 ATACATTGGAATATGGAGGAAGG - Intronic
1084596967 11:70122757-70122779 ACAGAGAGACAGAGGGAGGAAGG - Intronic
1084772764 11:71354623-71354645 ATTCAGAGACAGAAGGAGTATGG - Intergenic
1085097139 11:73770450-73770472 TTGCAGTGACAGATTTAGGATGG - Intergenic
1085302459 11:75466568-75466590 AGACTGTGAGAGATGAAGGAGGG - Intronic
1085790390 11:79492731-79492753 AAACAGTTACAGAGGGAGGATGG + Intergenic
1086226037 11:84510915-84510937 ATACAGGGACAGAGGGAGGAGGG + Intronic
1086370691 11:86152647-86152669 CTAGAGTGACAGGTGGAGGAAGG - Intergenic
1086841426 11:91689649-91689671 ATATAGTGACAAGTGGAGAAGGG - Intergenic
1088433444 11:109783784-109783806 AAATTGTGACAAATGGAGGAGGG - Intergenic
1089305804 11:117525356-117525378 ACAGAGAGACAGATGGAAGAAGG + Intronic
1090542199 11:127719930-127719952 ACACAGTGAGAGAAGGAGCAAGG + Intergenic
1090703339 11:129315426-129315448 TCACAGGGACAGATGGAGCAGGG + Intergenic
1091028252 11:132160867-132160889 AGGCAGTGAGAGAAGGAGGAGGG + Intronic
1092336445 12:7638404-7638426 GTACAGGGACAGAGGGAGGGGGG - Intergenic
1093708167 12:22298136-22298158 ATGCAGTGAGATATGGAGGAAGG - Intronic
1093902855 12:24655577-24655599 ATACAGTGAGAGAGAGAGGGGGG + Intergenic
1095863572 12:46947180-46947202 AGACATTTACAGTTGGAGGAAGG - Intergenic
1096296942 12:50392104-50392126 ATACAGTGACAGAAGCAGATTGG + Intronic
1096428069 12:51521018-51521040 CTACAGTGGCAGCTGGAGGTGGG - Intergenic
1096722273 12:53532231-53532253 TTAGGGTGACAGATGGAGGGTGG - Intronic
1096778337 12:53977302-53977324 ATACAAAGACAGAAAGAGGAGGG - Exonic
1096863114 12:54544323-54544345 ATGCAGATGCAGATGGAGGAGGG - Exonic
1097074170 12:56380307-56380329 ATACAAGGATAAATGGAGGATGG - Intergenic
1098167478 12:67713231-67713253 GTACAGAGACAGAAGGAGCAGGG - Intergenic
1098203503 12:68082354-68082376 GTACAGTGACAGAGAGAGGAGGG - Intergenic
1098307411 12:69115877-69115899 GTACAGAGACAGAGGGAGGGGGG + Intergenic
1098567649 12:71953869-71953891 ATACAGAGAAAGATGGAGTATGG + Intronic
1098719326 12:73875528-73875550 ATACAGTTACATATTGTGGAAGG + Intergenic
1098848387 12:75565851-75565873 ATGGAGTAACAGATGGGGGAAGG + Intergenic
1098849914 12:75583780-75583802 AGACAGAGAAAGATGGAGGGAGG - Intergenic
1099188259 12:79539253-79539275 AAACAGTAAGAGATGGTGGAAGG - Intergenic
1100020027 12:90057814-90057836 ATCCAGTGACTGATGGAGGCAGG - Intergenic
1100406694 12:94278057-94278079 ATACAGAGACAGAGGGAGGGGGG - Exonic
1100999371 12:100342450-100342472 ATACAGTAACAGATGCAAGGTGG - Intergenic
1101124630 12:101619206-101619228 ATAGACTGACAGTTGGAGGAGGG - Intronic
1101735720 12:107461363-107461385 ACACAGACACAGATGGAAGAAGG + Intronic
1102042559 12:109810011-109810033 CTACAGAGGCAGATGGCGGAAGG + Intronic
1102367423 12:112350567-112350589 ATATACTGACAGATTGGGGAGGG - Intronic
1103315019 12:120046226-120046248 GCACAGGGACTGATGGAGGATGG - Intronic
1103617939 12:122166876-122166898 TTTCAGTGACAGAAGGAGAAAGG + Intergenic
1104709535 12:130975939-130975961 AAACATTCACAGAGGGAGGAAGG - Intronic
1106470972 13:30053947-30053969 ATACAGAGACCGAGGGAGGGGGG + Intergenic
1108804865 13:54141951-54141973 ATACACTAACAGATGCAGGGAGG + Intergenic
1108901686 13:55417812-55417834 GTACAGAGACAGAGGGAGGGGGG - Intergenic
1109042103 13:57352185-57352207 TTACAGTAACAGGTGGTGGAAGG - Intergenic
1109274365 13:60287120-60287142 GTACAGAGACAGAGGGAGGGGGG - Intergenic
1110177839 13:72578786-72578808 ATACATTAACAAATAGAGGAAGG - Intergenic
1110395740 13:75027965-75027987 ATCCACTGACTGATGGAGGTAGG - Intergenic
1110952629 13:81515762-81515784 ATACAGAGAAAGAGGGAGGAGGG + Intergenic
1111340753 13:86882516-86882538 ATACAGAGACAGAGGGAGGGGGG - Intergenic
1111358017 13:87136346-87136368 ATACACAGAGAGATTGAGGAGGG - Intergenic
1112237668 13:97650917-97650939 ATACAGAGACAGAGGGAGGGGGG + Intergenic
1112980205 13:105374783-105374805 AGAGATTGACAGATGGAGGCGGG + Intergenic
1113222471 13:108120691-108120713 AAACAGAGACAGAAGGAGGGGGG - Intergenic
1113939963 13:114013611-114013633 AGAGAGAGACAGATGGAGGGGGG - Intronic
1116301147 14:43184865-43184887 ATACAGAGACAGAGAAAGGAGGG - Intergenic
1116784384 14:49270933-49270955 AGACATTGACAGATGGAAGCAGG - Intergenic
1118654090 14:67928367-67928389 ATACAGAGACAGAGGGAGGGGGG + Intronic
1119221472 14:72911450-72911472 ATACACTGACACATGCAGGGAGG + Intergenic
1121532280 14:94663586-94663608 AGAGAGAGAGAGATGGAGGAAGG - Intergenic
1122233708 14:100320385-100320407 ATGGAGGGACGGATGGAGGAGGG - Intergenic
1122812973 14:104298038-104298060 ATGCAGGGGCAGGTGGAGGAAGG - Intergenic
1123986220 15:25648549-25648571 AGAGGATGACAGATGGAGGATGG + Intergenic
1125095252 15:35842940-35842962 ACTCAGTGAAAGATGGAGAAGGG - Intergenic
1126223263 15:46239974-46239996 ATAGAGTGAAGGAAGGAGGAAGG + Intergenic
1126556011 15:49988442-49988464 AGAGAGGGACAGAGGGAGGAAGG + Intronic
1128342109 15:66829853-66829875 TTAAATTGACAGATGGTGGAGGG + Intergenic
1128716809 15:69914521-69914543 AGAGAGAGACAGAAGGAGGAGGG - Intergenic
1129258355 15:74347539-74347561 ATACAGTGACAAATAGAGCAGGG - Intronic
1130543329 15:84837806-84837828 CTACAGTGAGAGATGGAAAAAGG - Intronic
1130684772 15:86027344-86027366 AAAGAGGGACAGATGGAGGGAGG - Intergenic
1130706323 15:86236701-86236723 ATACAGAGACAGAGGGAGGGGGG + Intronic
1131006923 15:88985995-88986017 ATACAGAGACAGAGGGAGGGGGG + Intergenic
1131681897 15:94732455-94732477 AGAGAGTGACAGTTGGAGCAGGG - Intergenic
1133500852 16:6365240-6365262 ATAGAGGGACAGATGGATGGGGG + Intronic
1134328141 16:13225815-13225837 AGAGAGAGACAGATGGAGGAAGG + Intronic
1136351199 16:29709234-29709256 GTACAGAGACAGAGGGAGGGGGG - Intergenic
1138210546 16:55159567-55159589 ATACAGAGACACAGGGAAGATGG + Intergenic
1138272888 16:55708846-55708868 AGACAGTGACAGATAAAGGTGGG + Intergenic
1139457105 16:67089567-67089589 ATACAATTTCAAATGGAGGAAGG - Intronic
1139800963 16:69522291-69522313 ATACGGGGCCAGATGGGGGAAGG + Intergenic
1140530555 16:75662198-75662220 ATAGAGTGAGATATGGGGGAAGG + Intronic
1140895010 16:79317192-79317214 AAAGAGGGACAGATGAAGGAAGG - Intergenic
1141342604 16:83217085-83217107 ATACAGTGATGGATCAAGGAGGG - Intronic
1141400298 16:83741557-83741579 ATATAGTAATAGATGGAAGATGG - Intronic
1141597655 16:85107230-85107252 GTAGAGTGAGAGCTGGAGGAGGG - Intronic
1141899341 16:86980428-86980450 ATAGATTGATAGATGGATGATGG + Intergenic
1141996113 16:87637348-87637370 ATCCAGAGACAGACGGATGATGG - Intronic
1142707746 17:1707407-1707429 ACCCAGGGACAGATGGGGGAAGG - Exonic
1143284935 17:5781868-5781890 ATGCAGGTACAGGTGGAGGATGG + Intronic
1143284952 17:5781958-5781980 ATGCAGGTACAGGTGGAGGATGG + Intronic
1143326155 17:6099828-6099850 GTACAGAGACAGAGGGAGGGGGG - Intronic
1143969343 17:10783597-10783619 ATACAGTGATAAATGAAAGATGG - Intergenic
1144012371 17:11161845-11161867 ATACAGAGACAGAGGGAGGGGGG - Intergenic
1144127962 17:12220450-12220472 GTACAGAGACAGAAGGAGGGGGG + Intergenic
1144382781 17:14719116-14719138 ATATAGTGAGGGAAGGAGGAAGG - Intergenic
1144996261 17:19271314-19271336 GTCTAGTGACAGATAGAGGAAGG + Intronic
1145833655 17:27937474-27937496 GTACAGAGACAGAGGGAGGGGGG - Intergenic
1146926788 17:36751029-36751051 CTACGGTGACAGGAGGAGGAAGG + Intergenic
1147313520 17:39608045-39608067 AGAGAGTGACAGATGGCGGCGGG - Intronic
1148752506 17:49953362-49953384 ATACAGTGACACACACAGGAGGG + Intergenic
1148965387 17:51430709-51430731 ATACAGAGCAGGATGGAGGATGG + Intergenic
1149256149 17:54829000-54829022 ATAAAGTCACAGAAGGAGAATGG + Intergenic
1149515283 17:57276539-57276561 ATGCAGAGAAAGATAGAGGAGGG + Intronic
1149787618 17:59449543-59449565 ACACAGTGAAAGAAGGAGTAAGG - Intergenic
1151353377 17:73544599-73544621 ATACATGGACAGATGGATAATGG + Intronic
1151427702 17:74041755-74041777 ATGCAGGGACAGAGAGAGGAAGG - Intergenic
1152182073 17:78828707-78828729 CTTCAGTAACAGATGGAGAATGG + Intronic
1152276459 17:79360676-79360698 ATAAATTAACAGATGGCGGAGGG - Intronic
1153343964 18:4006529-4006551 TTGCAGTCACAGTTGGAGGAGGG + Intronic
1154005430 18:10523524-10523546 ATACAGAGACAGAGGTAGGGAGG + Intergenic
1155316938 18:24581372-24581394 ATACAGAGACAGAGGGCGGGGGG + Intergenic
1155613485 18:27695406-27695428 GTACAGAGACAGAGGGAGGGGGG - Intergenic
1155945150 18:31840364-31840386 ATAGAGAGACAGAGGGAGGGAGG + Intronic
1156426721 18:37021690-37021712 GTACAGAGACAGAGGGAGGGGGG - Intronic
1157587479 18:48813971-48813993 AGCCAGAGACAGATAGAGGAAGG + Intronic
1158402148 18:57130924-57130946 ACACAGTGAGAGAGGGAAGAAGG - Intergenic
1159274014 18:66192307-66192329 ATGAAGCCACAGATGGAGGAAGG - Intergenic
1161465731 19:4429255-4429277 CTGAAGGGACAGATGGAGGAGGG - Intronic
1166239566 19:41480699-41480721 ATACTGAGACAGAGGGAGGGGGG - Intergenic
1166411567 19:42558817-42558839 ATACAGGGACAGACGGAGGGGGG - Intronic
1166580813 19:43897292-43897314 ATACAGTGATATTTGGAGTACGG + Intronic
1167794334 19:51699625-51699647 ACACAGGGACATATGAAGGAAGG - Intergenic
1168475621 19:56672940-56672962 AAACAGGGATAGATAGAGGATGG + Intergenic
925783172 2:7402685-7402707 ACAGAGAGAAAGATGGAGGAAGG + Intergenic
925913703 2:8589560-8589582 ATAGAGAGAGAGAGGGAGGAGGG + Intergenic
928031636 2:27784628-27784650 ATAAAGACACAGAAGGAGGAAGG + Intronic
928308513 2:30191079-30191101 TTACAGAGACAGAGGGAGGGGGG - Intergenic
929236562 2:39611174-39611196 ATAGAGTGAGATATGGAGAAAGG + Intergenic
929801831 2:45111197-45111219 ATTCAGAGACAGATTGAGCACGG - Intergenic
931038474 2:58269178-58269200 ATACAGTGCTAGATTAAGGATGG - Intergenic
931091904 2:58895295-58895317 GTACAGAGACAGAGGGAGGGGGG + Intergenic
931138785 2:59434163-59434185 ACTCTGAGACAGATGGAGGACGG + Intergenic
932939480 2:76145778-76145800 ATACAGAGACAGGTATAGGAAGG + Intergenic
933526209 2:83443114-83443136 ATACAGGAACACTTGGAGGAAGG - Intergenic
934147038 2:89105058-89105080 ACACAGAGACAGAGGGAGGAGGG - Intergenic
934222228 2:90095537-90095559 ACACAGAGACAGAGGGAGGAGGG + Intergenic
934486843 2:94723867-94723889 AAACAGAGAGAGATGAAGGAGGG + Intergenic
934488597 2:94740044-94740066 AAACAGAGAGAGATGAAGGAGGG - Intergenic
934539260 2:95160458-95160480 ATTCAGGGGCAGATGGAGAAAGG - Intronic
934740622 2:96719356-96719378 AGACAGTGAAAGAGGGAGAAAGG - Intronic
934788916 2:97040239-97040261 TAATAGTGACATATGGAGGATGG + Intergenic
935190585 2:100775272-100775294 ATACTTTGACAAATGGATGAAGG + Intergenic
935421139 2:102870356-102870378 ACACAGTACCAGATGGAGGGAGG + Intergenic
935789261 2:106576052-106576074 CCACAGTGGCAGATGGAGGATGG - Intergenic
935895705 2:107735091-107735113 ATACTGTGTCACATGGATGATGG + Intergenic
936233934 2:110726791-110726813 AGACAGAGACAGACAGAGGAAGG + Intergenic
937752734 2:125497474-125497496 GTACAGAGACAGAGGGAGGAGGG - Intergenic
939185149 2:138851951-138851973 ATTCAATGACAGATGGATGTGGG + Intergenic
939265924 2:139872415-139872437 GTACAGAGACAGAGGGAGGGTGG - Intergenic
939404332 2:141736486-141736508 ACACAGAGACAGGTGGAAGATGG + Intronic
940155044 2:150646998-150647020 ATAGAATGCCAGATGGAGCATGG - Intergenic
940163709 2:150743489-150743511 ATACACATACAGTTGGAGGAGGG - Intergenic
942032670 2:171978388-171978410 ATACAGTGATAAAAGGAGAAAGG - Intronic
943446757 2:187995877-187995899 GTACAGAGACATAAGGAGGAGGG - Intergenic
947431790 2:230035524-230035546 ACACAGAGAGAGATAGAGGAGGG + Exonic
947598441 2:231429138-231429160 ATACAGAGACAGAAGGAGGGGGG + Intergenic
947697536 2:232204556-232204578 ATACAGTGCCAGGTGGGGGAGGG - Intronic
948475205 2:238213618-238213640 ATACAATAACAGCTGGAGGCTGG - Intergenic
948509768 2:238455989-238456011 AGGCAGTGACAAATGGGGGAGGG + Intergenic
948925713 2:241095643-241095665 ATTCCGTGACAGTTGGAAGATGG - Exonic
949071622 2:242028383-242028405 ATACCGTGAGAGATGGAGAAAGG + Intergenic
949071637 2:242028473-242028495 ATACTGTGAGAGACGGAGAAAGG + Intergenic
949071651 2:242028563-242028585 ATACCGTGAGAGACGGAGAAAGG + Intergenic
949071665 2:242028653-242028675 ATACTGTGAGAGACGGAGAAAGG + Intergenic
1169683848 20:8248253-8248275 AGCCAGTGACAGATGGATGAAGG - Intronic
1170560282 20:17551297-17551319 ACACAGTGAGAGTGGGAGGAAGG + Intronic
1170576593 20:17667385-17667407 AACCAGTGGAAGATGGAGGAAGG - Intronic
1171850398 20:30303941-30303963 ATAATGTGACAGGTGGTGGAGGG - Intergenic
1172511118 20:35501757-35501779 ATATAGAGGCAGATGGAGGATGG - Intronic
1172708565 20:36901985-36902007 ATACAGTGACAGATGGAGGAAGG + Intronic
1172843495 20:37915868-37915890 GGACAGGGACAGATGGAGGCAGG - Intronic
1173145422 20:40520401-40520423 AGAGAGGGACAGAGGGAGGAAGG - Intergenic
1173364049 20:42369144-42369166 ACACAGTGAGAAAGGGAGGATGG - Intronic
1173401244 20:42727946-42727968 ATACAGTGGTATTTGGAGGATGG - Intronic
1173428163 20:42960613-42960635 AAACAGTGACAGATGCAGGCTGG - Intronic
1173956104 20:47034020-47034042 ATTCAGTGATAAAGGGAGGAAGG + Intronic
1173964566 20:47102345-47102367 ATAGAGTGAGAGAGGGAGGATGG + Intronic
1174020008 20:47522487-47522509 ATACAGAGACAGAAGGAGGGGGG + Intronic
1174660549 20:52209185-52209207 GTACAGAGACAGAGGGAGGGGGG + Intergenic
1174725499 20:52857417-52857439 ATATAGTGAGGGATGGAGGGAGG + Intergenic
1175221157 20:57417291-57417313 ATTATGTGACAGATGGAGGGAGG + Intergenic
1175382676 20:58574641-58574663 ATGGAGAGATAGATGGAGGAAGG - Intergenic
1175433051 20:58920703-58920725 ATACAGAGACAGAAGGAGGGGGG + Intergenic
1175950148 20:62579093-62579115 AGACAGAGACAGAGGGAGGCAGG - Intergenic
1175965720 20:62659260-62659282 AGACAGAGACAGATGGAGATGGG + Intronic
1177332720 21:19683136-19683158 CTACAGAGACCGAAGGAGGAGGG - Intergenic
1178766282 21:35454414-35454436 CAACTGTGAAAGATGGAGGAAGG - Intronic
1178791573 21:35705108-35705130 AGACAGAGACAGAGAGAGGAAGG + Intronic
1179567486 21:42258334-42258356 ATAGAGGGAGGGATGGAGGAGGG - Intronic
1179567526 21:42258453-42258475 ATGCATTGAGGGATGGAGGAAGG - Intronic
1181421503 22:22802494-22802516 ATCTAGTGATACATGGAGGATGG + Intronic
1181841913 22:25670626-25670648 ATTCAGGGAGAGAGGGAGGAAGG - Intronic
1182046532 22:27278595-27278617 AGACAATGACAGAGGGAGGAAGG - Intergenic
1182100769 22:27655915-27655937 CTAGAGGGACAGATGGATGAGGG + Intergenic
1182590656 22:31377147-31377169 ATACAGAAACAGAAGGAGGGGGG + Intergenic
1182639511 22:31755116-31755138 ATACAGTAACAATAGGAGGATGG + Intronic
1183192367 22:36329827-36329849 ACACAGTCACATATGGAGGTAGG + Intronic
1183282663 22:36940662-36940684 GTACAGAGACAGAGGGAGGGGGG + Intergenic
1183861514 22:40673687-40673709 ATACAGTGACATCAAGAGGATGG - Intergenic
1184117340 22:42429923-42429945 ATGGAGTGACAGATAGATGAAGG + Intronic
1185207596 22:49549001-49549023 AGACAGAGACAGATGGAAGAGGG - Intronic
949408487 3:3739362-3739384 ACACAGTCATAGATGGAGGCAGG - Intronic
949996723 3:9623117-9623139 CTACAGTTACAGAGGGAGCATGG + Intergenic
950526914 3:13529573-13529595 ATAAAGGGAGGGATGGAGGAAGG - Intergenic
951274212 3:20665411-20665433 AAATAGTGAGAGATGGAGAAAGG - Intergenic
952207830 3:31198198-31198220 ATACAGTGATAGGTGGGGCATGG - Intergenic
952608438 3:35178817-35178839 CTACAGTGACAGAAGCAGGCAGG + Intergenic
952681386 3:36097512-36097534 ATACAGTGAAGGCAGGAGGAAGG - Intergenic
953837792 3:46362206-46362228 ACACTGTGACAGAAGGAGTATGG + Intergenic
954085378 3:48240099-48240121 ATACAGAGACAGAGGGAGCGGGG + Intergenic
957274111 3:78068206-78068228 ATACAGAGACAGAGAGAGGAGGG + Intergenic
957526366 3:81383601-81383623 ATGCAGTTACTGAAGGAGGAGGG + Intergenic
959096385 3:101961090-101961112 ATCCAGTGACAGATGGAAACTGG + Intergenic
959175431 3:102904029-102904051 GTACAGAGACAGAGGGAGGGTGG + Intergenic
959204776 3:103292458-103292480 ATTCAGAGACAGATGGGGGAAGG + Intergenic
960340401 3:116468067-116468089 CTCCAGTGACAGATAGTGGAAGG + Intronic
960611154 3:119555929-119555951 TTACAGAGGCAGATGGATGATGG - Intronic
960719956 3:120616184-120616206 GTACAGAGACAGAGGGAGGGGGG + Intergenic
961514376 3:127423562-127423584 AGAGAGTGGCAGACGGAGGAGGG - Intergenic
962189954 3:133300089-133300111 ATACAGTGAGCTATGGAGTAAGG - Intronic
962408400 3:135119797-135119819 ATAAAGTTCCAGATGGAAGAAGG - Intronic
962458906 3:135591058-135591080 CTACAGAGACAGAGGGAGGGTGG - Intergenic
962660117 3:137593571-137593593 GTAGAGTGTCTGATGGAGGATGG - Intergenic
965099398 3:164277427-164277449 ATACAGAGACAGAAGGAGGAGGG + Intergenic
965208086 3:165748017-165748039 ATACAGTGATCGATGGTGGGAGG + Intergenic
965819072 3:172666479-172666501 ATACAGAGACAGAGGGAGGGGGG - Intronic
966804730 3:183798142-183798164 ATACCGTGACAGCTGAAGGGTGG - Intronic
967139793 3:186546923-186546945 ATACAAGGATAAATGGAGGATGG - Exonic
967616146 3:191569128-191569150 GTACAGGGAAAGAAGGAGGAAGG - Intergenic
968051072 3:195655264-195655286 ATACTGTGAGAGACGGAGAAAGG + Intergenic
968051084 3:195655354-195655376 ATACCGTGAGAGATGGAGAAAGG + Intergenic
968104742 3:195992984-195993006 ATACCGTGAGAGATGGAGAAAGG - Intergenic
968104754 3:195993074-195993096 ATACTGTGAGAGACGGAGAAAGG - Intergenic
968303031 3:197630567-197630589 ATACCGTAAGAGATGGAGAAAGG - Intergenic
968303046 3:197630657-197630679 ATACTGTGAGAGACGGAGAAAGG - Intergenic
968619189 4:1596098-1596120 ACACAGAGACAGAGGGACGAGGG + Intergenic
969419457 4:7083413-7083435 ATCCGGTGACTGATGGAGGTGGG - Intergenic
971345645 4:25809645-25809667 AGAGAGAGAGAGATGGAGGAAGG - Intronic
972332156 4:38073964-38073986 AGACTGTGGCAGAGGGAGGATGG + Intronic
973828193 4:54730888-54730910 ATATAGTGACTGATGGAGGAAGG - Intronic
973939482 4:55891601-55891623 AAACAGTGACAGATGAAGTTTGG + Intronic
974183367 4:58412246-58412268 AGACAATGAAAGAGGGAGGAAGG - Intergenic
974933755 4:68389468-68389490 GTACAGAGACAGAGGGAGGGGGG + Intergenic
977232814 4:94472273-94472295 AGACCATGACAGATGGAAGAAGG - Intronic
977241255 4:94572715-94572737 ATACAGACACAGATGGGGCATGG + Intronic
977336850 4:95710347-95710369 AGAAAGGGACAGAGGGAGGAAGG - Intergenic
977751935 4:100620354-100620376 GTACAGAGACAGAGGGAGCAGGG + Intronic
978498789 4:109386820-109386842 GTACAGAGACAGAGGGAGGGGGG + Intergenic
978544682 4:109858242-109858264 ATAGAGTGACAGAGGGTAGAAGG + Intronic
979213470 4:118134233-118134255 ATTCAGTGAAGGATGGAGGGTGG + Intronic
979460449 4:120976774-120976796 ATACATAGACAGATAGATGACGG + Intergenic
980480076 4:133376832-133376854 GTACAGGGACAGAGGGAGGGGGG + Intergenic
981234608 4:142400483-142400505 TTAAAGTGAATGATGGAGGAAGG - Intronic
981796756 4:148604470-148604492 ATCCCATGACAGAAGGAGGAAGG - Intergenic
983724542 4:170904113-170904135 AGACAGTGAAAGATAGAGGCAGG + Intergenic
983768156 4:171512725-171512747 ATACAGAGGCAGAGGGAAGAGGG - Intergenic
983793289 4:171826215-171826237 TCACAGTGAAAGATGAAGGAAGG - Intronic
984559973 4:181256677-181256699 AGGCACTGACAGATGAAGGATGG + Intergenic
984883853 4:184432731-184432753 ACACAGACACAGAGGGAGGATGG + Intronic
984922455 4:184777794-184777816 AGACAGAGACAGAGGGAGGCAGG + Intronic
984941545 4:184936471-184936493 ATACAGAGACAGAGGGAGGGGGG - Intergenic
985009309 4:185566327-185566349 ATACAGAGACAGAGGGAGGGGGG + Intergenic
985507697 5:293281-293303 ATACTGTCAGAGATGGAGAAAGG + Intronic
985507716 5:293461-293483 ATACTGTCAGAGATGGAGAAAGG + Intronic
985740257 5:1611668-1611690 ATACTGTCAGAGATGGAGAAAGG - Intergenic
985740267 5:1611758-1611780 ATACTGTCAGAGATGGAGAAAGG - Intergenic
985740276 5:1611848-1611870 ATACTGTCAGAGATGGAGAAAGG - Intergenic
985977700 5:3434098-3434120 AAAAAGTGACAGAGGGAGGCAGG - Intergenic
986032423 5:3906599-3906621 ATAAAGAGACAGATTGAGGAGGG + Intergenic
986315697 5:6584958-6584980 ACACAGCGTCAGATGGAAGATGG - Intergenic
987016096 5:13820887-13820909 ATACACAGACATAGGGAGGAAGG + Intronic
987038279 5:14038949-14038971 AGACAGAGACAGATGGGAGAAGG - Intergenic
987507978 5:18798071-18798093 ATACAGAGACAGACGGAGGGAGG + Intergenic
988585007 5:32500541-32500563 ATACAGAGACAGGGGGAGGGGGG - Intergenic
988856620 5:35233609-35233631 GTACAGAGACAGAGGGAGGGGGG + Intergenic
988993953 5:36696634-36696656 ATAAAATGACAGAAGGAAGAAGG - Intergenic
989159607 5:38377730-38377752 ATAGAGTAAAAGAGGGAGGAAGG + Intronic
989279016 5:39620786-39620808 ATACAGTGACAAGAGGAGGAAGG - Intergenic
989439711 5:41456006-41456028 GTACAGTGATAGATGGAGTCTGG + Intronic
989574274 5:42974884-42974906 AGAAAGTGAGAGATGGAGAAGGG + Intergenic
989964379 5:50451124-50451146 ATAGAGTGACAGACGAAGAAAGG - Intergenic
991021610 5:61985268-61985290 GTACAGTGATGGATGGAGGCAGG - Intergenic
991173520 5:63657509-63657531 AGACAGAGACAGAGAGAGGATGG + Intergenic
992266759 5:75026358-75026380 GTACAGTGACACATTGAGAATGG - Exonic
993629815 5:90272298-90272320 ATAGACTAACAGATGGAGGAAGG + Intergenic
994865267 5:105260531-105260553 ATTCAGTGGAAGATGTAGGATGG + Intergenic
995469968 5:112490955-112490977 ATAGAGACACAGAGGGAGGAAGG + Intergenic
995743377 5:115378036-115378058 ATCCAGTGACTGACAGAGGAAGG + Intergenic
995956473 5:117782878-117782900 AAACAGGGATAGATGGGGGAGGG - Intergenic
997823461 5:137086197-137086219 ATGCAGTGAGAGATGCAGGGAGG - Intronic
998372418 5:141670463-141670485 ATACAGGGACAGAAAGTGGATGG - Intronic
999154429 5:149448262-149448284 GGACAGTGACAGAAGGATGAAGG - Intergenic
999805481 5:155077298-155077320 CTTTAGTGACAGATGGAGCATGG - Intergenic
1000652037 5:163830231-163830253 ACACAGTGTGAGAAGGAGGAGGG + Intergenic
1001053680 5:168432340-168432362 ATGCAGTGAGAGATGGAAGCCGG - Intronic
1002000931 5:176195946-176195968 AGCCACAGACAGATGGAGGAAGG + Intergenic
1002050292 5:176566700-176566722 TTCCAGTCACAGAAGGAGGAAGG + Intronic
1002253403 5:177943026-177943048 AGCCACAGACAGATGGAGGAAGG - Intergenic
1002298675 5:178245694-178245716 ATACATTGGTAGATGGAGGATGG - Intronic
1002584348 5:180232646-180232668 CTACAGTGAAAGAGGGAAGAGGG + Intergenic
1002795712 6:469706-469728 ACACAGAGACAGAGAGAGGAGGG - Intergenic
1003255386 6:4470746-4470768 GTACAGAGACAGAGGGAGGGGGG + Intergenic
1003374457 6:5563072-5563094 GTACAGAGACAGAGGGAGGGGGG + Intronic
1003392740 6:5727571-5727593 ATACAGTAACAGCTGCAGGGAGG - Intronic
1004308565 6:14523400-14523422 ACACAGTGACAGATAAAGTAAGG - Intergenic
1004453260 6:15767234-15767256 ATACAGTTACATAAGGAAGAAGG + Intergenic
1004743081 6:18482081-18482103 ATAGAGGTACAGATGGAGGCAGG - Intergenic
1005047226 6:21653867-21653889 ATACAGAGACAGAGGGAGGGGGG + Intergenic
1005133371 6:22538048-22538070 CTACAGAGACACATGGAAGATGG + Intergenic
1005922521 6:30415125-30415147 ACACAGGGAGACATGGAGGAGGG + Intergenic
1005982215 6:30845171-30845193 GTACAGAGACAGAGGGAGGGGGG + Intergenic
1007020829 6:38519428-38519450 ATGCAGTGACAGATGAAGACAGG + Intronic
1008651462 6:53568159-53568181 AGACAGTGAGAGATGAAGAAAGG + Intronic
1009288348 6:61851830-61851852 ATACAGTGAGAGATAGGTGAAGG + Intronic
1009690633 6:67028029-67028051 ATAGAGTGATAGATGCAGGTGGG - Intergenic
1010472037 6:76240217-76240239 ACACAATGACAGATGCAGAAGGG - Intergenic
1011535176 6:88369262-88369284 ATCCAGTGACGAATGGATGATGG - Intergenic
1011575810 6:88797787-88797809 ATAGAATGACAGAAGGAGAAAGG + Intronic
1011714164 6:90086800-90086822 ATAAAGTGAAAGAAGGAGGTTGG - Intronic
1012581549 6:100876061-100876083 AGACTGTGACTGATGGAGTAGGG + Intronic
1012999084 6:106003937-106003959 GAGGAGTGACAGATGGAGGAAGG + Intergenic
1013719520 6:113007163-113007185 AAACAGTAGCAGATGGACGAAGG + Intergenic
1014992387 6:128097242-128097264 ATAAAGTGACAGAGGGTGGATGG + Intronic
1015604465 6:134941021-134941043 AAACAGTGACATCTGGTGGAAGG + Intronic
1015705827 6:136086425-136086447 GTACAGAGACAGAGGGAGGGGGG + Intronic
1016443865 6:144112492-144112514 ATACAGTGGCAGATGCTTGAAGG + Intergenic
1016938872 6:149468480-149468502 AAGCAGTCACATATGGAGGAAGG + Intronic
1017385385 6:153876709-153876731 AGAGAGAGAGAGATGGAGGAAGG + Intergenic
1017680110 6:156854763-156854785 AAACAGTGAAAGATTTAGGAAGG + Intronic
1019685096 7:2377454-2377476 TCAAAGTGAAAGATGGAGGAAGG + Intronic
1019944608 7:4316732-4316754 AGAGAGTGACAGAGGAAGGAAGG + Intergenic
1020011480 7:4807970-4807992 AGACAGGGAGAGAGGGAGGAGGG - Intronic
1020350145 7:7210504-7210526 GTACAGAGACAGAGGGAGGGAGG + Intronic
1020464438 7:8461215-8461237 GTAATGTGACAGAGGGAGGATGG - Intronic
1021176985 7:17460634-17460656 ATACAGAGACAGAGGGAGGGAGG + Intergenic
1021410058 7:20320103-20320125 ATACACTCACACATGGGGGATGG - Intergenic
1021837341 7:24692594-24692616 ATACAGTTTCAGCTGGTGGAAGG + Exonic
1021917910 7:25454336-25454358 ACACAGTGCTGGATGGAGGAGGG - Intergenic
1021946470 7:25732729-25732751 GTACAGAGACAGAGGGAGGGAGG + Intergenic
1022366008 7:29717657-29717679 GTACAGAGACAGAGGGAGGGGGG - Intergenic
1023181049 7:37484224-37484246 ATGTGGTGACAGCTGGAGGAAGG + Intergenic
1023994843 7:45153003-45153025 GCACAGTGACAGAGGGAGGGAGG - Intergenic
1024193063 7:47032282-47032304 TTACAGAGACAGAGGGAGGGGGG - Intergenic
1024331799 7:48162376-48162398 ATAAAGAGACACATAGAGGAAGG + Intergenic
1024974318 7:55099503-55099525 ATGCAGTCCCAGATGGAGGGGGG + Intronic
1025735541 7:64143606-64143628 ATGCAGGGACGGATGGAGGGAGG + Intronic
1025795143 7:64732645-64732667 GTACAGAGACAGAGGGAGGGGGG + Intergenic
1028073122 7:86477148-86477170 ATAGAGTAACAGCTGGAGGTAGG - Intergenic
1028935468 7:96459171-96459193 ATAGAGTGACAGAAGGATGTGGG + Intergenic
1029210165 7:98901381-98901403 ATACAGTCACATATGGAGTTAGG + Intronic
1030189264 7:106794437-106794459 ATCCAGTGACTGATGGAGACAGG - Intergenic
1030260856 7:107563257-107563279 CTACAGTGACACGTGGGGGAGGG - Intronic
1030407115 7:109128864-109128886 GTACAGAGACAGAGGGAGGGGGG + Intergenic
1030509918 7:110471390-110471412 AGAGAGAGAGAGATGGAGGATGG + Intergenic
1031049905 7:116934609-116934631 ATAGAGTGTCAGCTGCAGGAGGG + Intergenic
1032291826 7:130596023-130596045 TGACAGTGACAAATGGAGGTGGG + Intronic
1032631833 7:133661590-133661612 ATACAGAGACAAAAGGAGGGGGG - Intronic
1033643815 7:143286245-143286267 CTACAGGGAGAGAGGGAGGATGG - Intronic
1034020824 7:147640767-147640789 ATACAGAGACAGAGAGAGGAAGG + Intronic
1035878261 8:3215304-3215326 ATACATTGACTGATAGATGATGG + Intronic
1036279041 8:7383529-7383551 ATAAATTGACAGAGGGAGGAAGG + Intronic
1036342477 8:7928345-7928367 ATAAATTGACGGAGGGAGGAAGG - Intronic
1036471338 8:9055532-9055554 ATACATTGACAGGTGGGGGAAGG + Intronic
1036644495 8:10603172-10603194 ATTGAGTGAGAGATGGAGAAAGG + Intergenic
1037007882 8:13804868-13804890 AAACAGTGACACATGAGGGAAGG + Intergenic
1037079680 8:14768729-14768751 GAACACTTACAGATGGAGGAAGG + Intronic
1037127949 8:15372883-15372905 ATAGAGTGGATGATGGAGGAGGG - Intergenic
1037410873 8:18595459-18595481 AGACAGAGACAGACGGAGGGAGG + Intronic
1037648040 8:20811578-20811600 AGGCAGAGACAGATGGAGGGTGG + Intergenic
1037669733 8:21004051-21004073 ATAGATGGATAGATGGAGGATGG + Intergenic
1037848448 8:22305738-22305760 GTACAGTGACTGAGGGAGAAAGG + Intronic
1038497579 8:28014770-28014792 TTCCACTGACAGATGGAGAAGGG + Intergenic
1038873564 8:31522535-31522557 ATACAGAGACAGAGGAAGGGGGG + Intergenic
1039429545 8:37515216-37515238 ATATTGTGTCAGATGGATGAGGG - Intergenic
1040988136 8:53318627-53318649 TTACAGAGACAGAGGGAGGGGGG - Intergenic
1041182841 8:55266348-55266370 AGACAGAGACAGCTGGAGGATGG - Intronic
1041691398 8:60691489-60691511 AAACAGTGAGAAAAGGAGGATGG - Intronic
1041780167 8:61569103-61569125 ATACAGGCACAGGTAGAGGATGG + Intronic
1042352737 8:67794193-67794215 ACACCTTGCCAGATGGAGGAGGG - Intergenic
1043450086 8:80357555-80357577 ATAAACTGACAGAGGGACGAAGG - Intergenic
1044542138 8:93419929-93419951 AGACAGAGACAGAGAGAGGAAGG - Intergenic
1046193523 8:110830657-110830679 GTACAGTGACATCTGGTGGAGGG - Intergenic
1046950516 8:120015690-120015712 GTACAGAGACAGAGGGAGGGGGG + Intronic
1046961126 8:120114074-120114096 ATACAGTCACAGAGGGAGCAGGG + Intronic
1047151868 8:122273259-122273281 AGACAGTGGCACATGAAGGAGGG + Intergenic
1047284971 8:123479981-123480003 GTACAGAGACAGAGGGAGGGAGG - Intergenic
1047304997 8:123645518-123645540 AGACAGAGACAGATGGAGGTGGG + Exonic
1048696288 8:137031705-137031727 ATACAGTGAGAGAGAGAGAATGG - Intergenic
1049350770 8:142163401-142163423 ATGGATTGACGGATGGAGGATGG + Intergenic
1050046688 9:1553675-1553697 AGACACTGGCAGATGCAGGAGGG + Intergenic
1050470256 9:5981098-5981120 TTACAGTGAAGGATGGAGAATGG - Intronic
1050784037 9:9376390-9376412 ATAATTTGACTGATGGAGGAAGG - Intronic
1050818483 9:9846779-9846801 AAACATTGAGAGCTGGAGGAAGG + Intronic
1050901453 9:10953904-10953926 ACAGGGTGAGAGATGGAGGATGG + Intergenic
1052636161 9:31107414-31107436 ATTTAGTGACACATGGAGAATGG - Intergenic
1052718358 9:32145696-32145718 ATACAGAGACAGCGGGAGGGGGG - Intergenic
1053669192 9:40344319-40344341 AAACAGAGAGAGATGAAGGAGGG + Intergenic
1053670949 9:40360462-40360484 AAACAGAGAGAGATGAAGGAGGG - Intergenic
1053844922 9:42226497-42226519 ACACAGAGAGAGAGGGAGGAAGG - Intergenic
1053918993 9:42970560-42970582 AAACAGAGAGAGATGAAGGAGGG + Intergenic
1054513664 9:66015839-66015861 AAACAGAGAGAGATGAAGGAGGG + Intergenic
1054515420 9:66031971-66031993 AAACAGAGAGAGATGAAGGAGGG - Intergenic
1055309277 9:74961722-74961744 ATACAGAGACAGCTGGAAGGTGG + Intergenic
1056317147 9:85401002-85401024 GTACAGTGTCATATGAAGGAAGG - Intergenic
1056903454 9:90623437-90623459 ATACATAGACAGCTAGAGGAAGG + Intronic
1057177492 9:93010632-93010654 ACACAGAGACAGAGGAAGGAGGG + Intronic
1057177505 9:93010701-93010723 ACACAGAGACAGAGGAAGGAGGG + Intronic
1057398447 9:94701255-94701277 ATACAGGGCCAGGTGGAGGATGG - Intergenic
1058935794 9:109768058-109768080 AAACAGTGAAGGAAGGAGGAAGG + Intronic
1060045701 9:120338413-120338435 ATACAGTGATTGATTGATGATGG - Intergenic
1060541463 9:124433350-124433372 AAAGAGAGAGAGATGGAGGAAGG + Intergenic
1060954397 9:127628182-127628204 ATAAAGTGACAGATAGAGATGGG - Intronic
1061587535 9:131578578-131578600 ACACAGCGAGCGATGGAGGAGGG + Exonic
1061911797 9:133728956-133728978 ATAGATGGAGAGATGGAGGACGG + Intronic
1061996634 9:134189495-134189517 ATACAGAGACAGAGGGAGAGTGG + Intergenic
1185562542 X:1070772-1070794 AGAAAGAGAGAGATGGAGGAAGG + Intergenic
1185966819 X:4614907-4614929 AGACAGAGACAGAGAGAGGAGGG + Intergenic
1187283534 X:17881315-17881337 ATACAGAGACAGAGGGAGGGGGG + Intergenic
1188139717 X:26534801-26534823 ATACTTTGACAGGTGGTGGAAGG + Intergenic
1189511466 X:41666428-41666450 AGAGAGAGACAGAGGGAGGAAGG - Intronic
1189976016 X:46461878-46461900 GGACAGTGACAGATGTAGGAAGG - Intronic
1189983055 X:46529788-46529810 GGACAGTGACAGATGTAGGACGG + Intronic
1190011681 X:46790693-46790715 ATCCAGTGACTGATGGATGCGGG - Intergenic
1190538813 X:51456616-51456638 ATACAGAGACAGAGGGAGGGGGG - Intergenic
1191915007 X:66192044-66192066 AAACACTAACAGAAGGAGGAAGG + Intronic
1191936197 X:66429621-66429643 ATACAGAGACAGAGGGAGGGGGG + Intergenic
1192095090 X:68202155-68202177 TTAAAGTGGCAGATGAAGGAGGG + Intronic
1192243015 X:69349652-69349674 ATAGACTGACAGTGGGAGGAAGG - Intergenic
1192776780 X:74253914-74253936 TTACAGAGACAGAGGGAGGGGGG - Intergenic
1192777522 X:74260347-74260369 ATACAGAGGCAGAGGGAGGGGGG - Intergenic
1193620747 X:83750388-83750410 ATTCTGTGATAGAAGGAGGAAGG - Intergenic
1194222546 X:91213611-91213633 ATATAGAGACAGAGGAAGGAGGG + Intergenic
1194663171 X:96648391-96648413 TGACAGTGCCAGATAGAGGAGGG - Intergenic
1194988609 X:100520232-100520254 ATGCAGTGACACATAGAGGGAGG - Intergenic
1195171496 X:102272872-102272894 ATTCAGTGACTGGTGGAGGCAGG + Intergenic
1195187364 X:102414227-102414249 ATTCAGTGACTGGTGGAGGCAGG - Intronic
1196704630 X:118706411-118706433 ATCCAGTGCCAGCTGAAGGAAGG - Intergenic
1196978123 X:121182413-121182435 ATACATGGACACATGGAGGGGGG - Intergenic
1197161955 X:123333835-123333857 ATACAGTAAGAGATGAAGGAAGG - Intronic
1197632878 X:128882316-128882338 CTACTCTGACAGATGTAGGAGGG - Intergenic
1198120098 X:133583927-133583949 ACACAGGGACAGTGGGAGGATGG - Intronic
1198481912 X:137049326-137049348 AGAGAGAGAGAGATGGAGGAAGG - Intergenic
1198786421 X:140293242-140293264 AGAAAGTGACAGAAGCAGGAAGG - Intergenic
1199018648 X:142848787-142848809 ATACAGAGACAGAGGGAGGGGGG - Intergenic
1199301534 X:146219741-146219763 ATACAGTGTTAGAAGGAAGAGGG - Intergenic
1199503119 X:148531182-148531204 AGACTGTGTCAGATGGGGGATGG - Intronic
1199880070 X:151967133-151967155 ACACACTGACAAATGGAGCAGGG - Intronic
1200330038 X:155285912-155285934 ATACCGAGACAGAGGGAGGGGGG + Intronic
1200559074 Y:4677376-4677398 ATATAGAGACAGAAGAAGGAGGG + Intergenic
1201651045 Y:16287316-16287338 ATAGAGAGATAGATGAAGGATGG - Intergenic
1201900461 Y:19042783-19042805 TTACAGAGACAGAGGGAGGAGGG - Intergenic