ID: 1172716680

View in Genome Browser
Species Human (GRCh38)
Location 20:36969447-36969469
Sequence ACTTGGCCTTGGAGTGTAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172716674_1172716680 14 Left 1172716674 20:36969410-36969432 CCCTATGTAGACAAACTGCTTCA No data
Right 1172716680 20:36969447-36969469 ACTTGGCCTTGGAGTGTAACAGG No data
1172716675_1172716680 13 Left 1172716675 20:36969411-36969433 CCTATGTAGACAAACTGCTTCAA No data
Right 1172716680 20:36969447-36969469 ACTTGGCCTTGGAGTGTAACAGG No data
1172716673_1172716680 27 Left 1172716673 20:36969397-36969419 CCACAGAGTAAGGCCCTATGTAG No data
Right 1172716680 20:36969447-36969469 ACTTGGCCTTGGAGTGTAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172716680 Original CRISPR ACTTGGCCTTGGAGTGTAAC AGG Intergenic
No off target data available for this crispr