ID: 1172719028

View in Genome Browser
Species Human (GRCh38)
Location 20:36985169-36985191
Sequence CCGGGAGGCCTTTTGTCTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172719028_1172719039 15 Left 1172719028 20:36985169-36985191 CCAGGAGACAAAAGGCCTCCCGG No data
Right 1172719039 20:36985207-36985229 ATAATGGCCTTGAACTGAAGGGG No data
1172719028_1172719038 14 Left 1172719028 20:36985169-36985191 CCAGGAGACAAAAGGCCTCCCGG No data
Right 1172719038 20:36985206-36985228 AATAATGGCCTTGAACTGAAGGG No data
1172719028_1172719033 -1 Left 1172719028 20:36985169-36985191 CCAGGAGACAAAAGGCCTCCCGG No data
Right 1172719033 20:36985191-36985213 GTCAGATCTCCACCCAATAATGG No data
1172719028_1172719037 13 Left 1172719028 20:36985169-36985191 CCAGGAGACAAAAGGCCTCCCGG No data
Right 1172719037 20:36985205-36985227 CAATAATGGCCTTGAACTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172719028 Original CRISPR CCGGGAGGCCTTTTGTCTCC TGG (reversed) Intergenic
No off target data available for this crispr