ID: 1172719245

View in Genome Browser
Species Human (GRCh38)
Location 20:36986727-36986749
Sequence CTTGATGTCCAGAAGGTGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172719245_1172719248 0 Left 1172719245 20:36986727-36986749 CCTGTCACCTTCTGGACATCAAG No data
Right 1172719248 20:36986750-36986772 CTCCAGATGACCCTCAGTGAGGG No data
1172719245_1172719247 -1 Left 1172719245 20:36986727-36986749 CCTGTCACCTTCTGGACATCAAG No data
Right 1172719247 20:36986749-36986771 GCTCCAGATGACCCTCAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172719245 Original CRISPR CTTGATGTCCAGAAGGTGAC AGG (reversed) Intergenic
No off target data available for this crispr