ID: 1172727760

View in Genome Browser
Species Human (GRCh38)
Location 20:37059495-37059517
Sequence AGTCCGTATGTACCACCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 40
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 38}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172727760_1172727763 -9 Left 1172727760 20:37059495-37059517 CCTGCTGGTGGTACATACGGACT 0: 1
1: 0
2: 0
3: 1
4: 38
Right 1172727763 20:37059509-37059531 ATACGGACTTTCAATTGGGAAGG 0: 1
1: 0
2: 0
3: 4
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172727760 Original CRISPR AGTCCGTATGTACCACCAGC AGG (reversed) Intronic
900858662 1:5207255-5207277 ATTCAGTATGGACCACCAGAAGG + Intergenic
904594584 1:31635368-31635390 GGGCCTTATGGACCACCAGCTGG - Exonic
905689021 1:39929059-39929081 AGCCCGTATGGACTGCCAGCTGG - Intergenic
908163235 1:61432386-61432408 AGTGAGGATGTACCACCAGGAGG - Intronic
913407075 1:118506276-118506298 AGTCTTTATGTGCCACCAGTTGG - Intergenic
915341005 1:155176774-155176796 TGCCAGTATGTACCACCAGGTGG + Intronic
920238934 1:204529515-204529537 GGGCCTTATGGACCACCAGCTGG - Intronic
923099081 1:230798032-230798054 AGTCCTTGTTTACCACCAGATGG + Intronic
923237211 1:232046079-232046101 ACTCCTTATGTCCCACTAGCAGG + Intergenic
1065354142 10:24822676-24822698 AGTCTGTGTGTACCACTAACAGG + Intergenic
1065696984 10:28388863-28388885 TGTCCTTATGTCCCATCAGCGGG - Intergenic
1080553596 11:33395918-33395940 ACTTCGCATGTACCACCATCAGG - Intergenic
1083364829 11:62135753-62135775 AGCGCGTATCCACCACCAGCAGG - Intronic
1085780983 11:79408839-79408861 AGTCCTTCTGTACCACCTGATGG - Intronic
1097960984 12:65531754-65531776 AGTCAGTATGACCCACCAGAAGG - Intergenic
1101570823 12:105952047-105952069 AGTCAGGATGTTCCCCCAGCAGG - Intergenic
1104902521 12:132197157-132197179 AGCACCTCTGTACCACCAGCCGG + Exonic
1114175692 14:20317630-20317652 ATTCCGAATCTTCCACCAGCTGG + Intronic
1116738924 14:48730479-48730501 ACCCTGTATGTAGCACCAGCTGG - Intergenic
1120917262 14:89721052-89721074 AGTCAAAATCTACCACCAGCTGG + Intergenic
1122907842 14:104810428-104810450 AGTCCGCCTGCACCACCAACAGG + Intergenic
1132348153 15:101121028-101121050 ACTCCGTCTGTACCTCCTGCTGG - Intergenic
932009408 2:67960288-67960310 AGCCAGGATGTACCAACAGCTGG - Intergenic
942208108 2:173643298-173643320 AGTCTGGATGTGCCAACAGCAGG + Intergenic
942506781 2:176650328-176650350 AGCCCGTAAGACCCACCAGCAGG - Intergenic
1169319237 20:4617651-4617673 AGCCCGTCTGATCCACCAGCTGG + Intergenic
1172727760 20:37059495-37059517 AGTCCGTATGTACCACCAGCAGG - Intronic
1180869719 22:19139236-19139258 TGTTCTTATGTACCACCTGCCGG + Exonic
1182233624 22:28858356-28858378 ACTCCGTATTTGCCACCATCAGG - Intergenic
978506494 4:109463371-109463393 TGCCCATATGTATCACCAGCAGG - Exonic
978740912 4:112136819-112136841 ATTCTGTATGTATCTCCAGCTGG - Intergenic
1000374247 5:160564710-160564732 AGACCATATGTCCCACCAGCTGG - Exonic
1007200088 6:40100035-40100057 AGGCTGTATTTACCACCAACTGG + Intergenic
1018802841 6:167236722-167236744 AGCCTGAATGTACCACCAGATGG + Intergenic
1018807747 6:167274317-167274339 AGCCTGAATGTACCACCAGATGG - Intronic
1022092581 7:27117307-27117329 ATTCCTTGTGTACCCCCAGCTGG - Intronic
1029531282 7:101126988-101127010 AGTCCGTCTGAACAGCCAGCGGG - Intergenic
1031583820 7:123508628-123508650 AATCCTTAAGTACCACTAGCTGG + Intronic
1037797809 8:22010888-22010910 AGTCCGTATTCCCCACTAGCTGG - Intergenic
1049695701 8:143983446-143983468 AGGCCGAGTGCACCACCAGCTGG + Exonic