ID: 1172730394

View in Genome Browser
Species Human (GRCh38)
Location 20:37082211-37082233
Sequence CTGTATCATCACCAGCAGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 141}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172730394_1172730403 24 Left 1172730394 20:37082211-37082233 CCCCCCTGCTGGTGATGATACAG 0: 1
1: 0
2: 0
3: 16
4: 141
Right 1172730403 20:37082258-37082280 GAGCACAGCATAGTTCACTGAGG 0: 1
1: 0
2: 0
3: 10
4: 157
1172730394_1172730399 -3 Left 1172730394 20:37082211-37082233 CCCCCCTGCTGGTGATGATACAG 0: 1
1: 0
2: 0
3: 16
4: 141
Right 1172730399 20:37082231-37082253 CAGTCAGCCCTGCACCTCAGTGG 0: 1
1: 0
2: 1
3: 36
4: 278

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172730394 Original CRISPR CTGTATCATCACCAGCAGGG GGG (reversed) Intronic
900385178 1:2407321-2407343 CTGTGTCACCAGCAGGAGGGTGG - Intronic
901371744 1:8804696-8804718 CTGCATTCTCACCAGCAGGAAGG - Intronic
903569073 1:24291103-24291125 CTGTGTCATCACCACCTGTGGGG - Intergenic
906137556 1:43510188-43510210 CTGAGTCATCTCCAGAAGGGCGG + Intergenic
906944800 1:50286525-50286547 CTCTACCATCTCCAGCAGTGTGG + Intergenic
908319560 1:62966816-62966838 CTGTGTCATCCCCAGCAGCAAGG + Intergenic
909089571 1:71208529-71208551 CTGTAACATGATCAGCATGGGGG + Intergenic
911174390 1:94804591-94804613 CTTTATCACCACTAGCAGCGTGG - Intergenic
913193488 1:116433317-116433339 CTGAGCCATCACCAGCTGGGTGG - Intergenic
915570520 1:156743027-156743049 ATGGAGCATCAACAGCAGGGTGG - Intronic
916314876 1:163438073-163438095 CTGTATCCTCCCCTGCTGGGAGG + Intergenic
916595264 1:166236667-166236689 CTGTCTCTTCCCCAGCTGGGTGG + Intergenic
917474316 1:175355335-175355357 CTCTCTCATCAACAGCAGGCTGG + Intronic
918037509 1:180889523-180889545 CTGTAGCAACACCAGCATGGTGG + Exonic
922457106 1:225783874-225783896 CTGTATCAAAAGCAGCAAGGAGG - Intronic
923016146 1:230128058-230128080 GTTTCTCATCACCAGCTGGGTGG + Intronic
1063145326 10:3290550-3290572 CTGTGTCAACACCAGCAGGCAGG - Intergenic
1064444207 10:15379199-15379221 GTGTCTAATCACTAGCAGGGAGG - Intergenic
1068976699 10:63017661-63017683 CTGTACCATTACCAGTAGAGGGG + Intergenic
1070325187 10:75384222-75384244 CTGCACCATCACCAGGAGGGAGG - Intergenic
1071416900 10:85449916-85449938 CTTTAAGATCACCAGCAGAGTGG + Intergenic
1072081584 10:92037848-92037870 TTGCATCATCACAAGAAGGGTGG + Intergenic
1072632174 10:97153986-97154008 CTTTACCATCACCAGCCGGCAGG + Intronic
1072867748 10:99081926-99081948 TTGTATCATCATCGGCTGGGCGG - Intronic
1073658901 10:105450112-105450134 ATGTCTCATCACCATCAGGAAGG - Intergenic
1074833016 10:117263160-117263182 CTGTGTCAGCACCAGCAGGAGGG + Intronic
1076190228 10:128477868-128477890 CTGGGTCATCACCATCATGGGGG - Intergenic
1076655807 10:132022584-132022606 AGGTTTCATCACCAGCAGGGAGG - Intergenic
1077599802 11:3566330-3566352 GTGTCTCATCACCTGCAGGTGGG + Intergenic
1078555449 11:12321596-12321618 CTGCATCATCACCATCAGTGAGG + Intronic
1078876225 11:15401057-15401079 GTGTGTCTTCACCAGCAAGGTGG + Intergenic
1080549754 11:33362534-33362556 TTGTATTATGGCCAGCAGGGGGG + Intergenic
1080953535 11:37065289-37065311 CTGTCTCATTTCAAGCAGGGAGG + Intergenic
1087276579 11:96166968-96166990 TGGTATCATCAGCATCAGGGAGG - Intronic
1091651452 12:2313329-2313351 CTGAATGATCACCTGCAAGGAGG - Intronic
1091799141 12:3313778-3313800 CTGTATCCTCGCCAGCAGATGGG + Intergenic
1092425951 12:8375689-8375711 GTGTGTCATCACCTGCAGGTGGG + Intergenic
1093276645 12:17136977-17136999 CTGCCTCATAACCAGAAGGGAGG + Intergenic
1097284902 12:57869616-57869638 CTGCTTCATTACCAGCTGGGGGG - Intergenic
1103029914 12:117604769-117604791 CTGTAGCATCTCCAGTAGTGAGG - Intronic
1103331661 12:120158475-120158497 CCACACCATCACCAGCAGGGTGG - Exonic
1110567679 13:76972560-76972582 CTGTGACTTCACCAGCAGGAAGG + Intergenic
1116287233 14:42988514-42988536 CTGTAAAATCAACAGCAGGCTGG - Intergenic
1122123595 14:99567460-99567482 CTGTGTTCTCACCAGCAGGAGGG + Intronic
1122502147 14:102207926-102207948 CTCTCTCAACACCAGCAGAGAGG + Intronic
1122742994 14:103882585-103882607 CTGTATTATCTCCAGCATGTAGG + Intergenic
1124793421 15:32751824-32751846 TTGTAACATCGCCAGCACGGTGG + Intergenic
1127180106 15:56406590-56406612 CTGTATCATCACCAACACTTGGG + Intronic
1128058722 15:64719770-64719792 CTGTATTGTCTCCAGCAGTGAGG + Intergenic
1129395751 15:75245090-75245112 CTGGATCATCAGCAGCAGCACGG + Intergenic
1129845909 15:78767640-78767662 CTGCAGGCTCACCAGCAGGGGGG + Intronic
1132332483 15:101022485-101022507 CTGTAAGATCTCCAGGAGGGTGG - Exonic
1133372394 16:5255211-5255233 GTGTGTCATCACCTGCAGGTGGG - Intergenic
1133708690 16:8380187-8380209 CTGTGTCCTTACAAGCAGGGTGG - Intergenic
1133878880 16:9762241-9762263 CTGAGTCATCACCAGAAGGGAGG + Exonic
1139092464 16:63665056-63665078 CTCTTTCATCAACAGCAGGGAGG - Intergenic
1139266444 16:65643819-65643841 CTGTATCATCTCCCTCATGGTGG - Intergenic
1139396607 16:66644933-66644955 CTGTACCCTCACCATCAGTGTGG - Intronic
1141160149 16:81624010-81624032 CTGTATCAGCAGAAGCAGAGGGG - Intronic
1141932577 16:87215973-87215995 CTGTTTCCTCACCAGAAGGAAGG + Intronic
1142362040 16:89631963-89631985 CTGTATGCTGGCCAGCAGGGAGG + Intronic
1143057036 17:4170196-4170218 CTGTGTCATCACCCACAGTGGGG - Intronic
1143732803 17:8890545-8890567 CTGGATCCTAACCAGCTGGGTGG - Intronic
1147791034 17:43014379-43014401 CTGTATGTTCACCAACAGTGCGG + Exonic
1150504843 17:65688354-65688376 CAGTTTCATCACCAGCAGGTGGG + Intronic
1153953702 18:10077963-10077985 CTGAAGCTTCACCAGGAGGGAGG - Intergenic
1155615356 18:27715725-27715747 CTGTAACATCAGAAGTAGGGAGG - Intergenic
1156361031 18:36384814-36384836 TTGCATCATCACCAGGAGGGAGG - Intronic
1157851099 18:51051704-51051726 CTTTATCATCACCAGCAACCAGG - Intronic
1158403204 18:57139585-57139607 CTGTGTCACCAACAGCAGGCGGG + Intergenic
1165335331 19:35165913-35165935 CTGCATGTTCAACAGCAGGGAGG + Intronic
926424372 2:12727851-12727873 CTGAGCCATAACCAGCAGGGTGG - Intronic
927094580 2:19737887-19737909 ATGGATCTTCAGCAGCAGGGTGG + Intergenic
930053244 2:47233296-47233318 CTGGCCCATCACCGGCAGGGTGG - Intergenic
932732969 2:74233462-74233484 CAGGATGGTCACCAGCAGGGCGG + Exonic
937052582 2:118904562-118904584 CTGTATCCTCACCATTAAGGGGG - Intergenic
937919181 2:127118282-127118304 GGGTCTCAGCACCAGCAGGGTGG + Intergenic
945062719 2:205923227-205923249 CTGGCTCCTCACCAGCATGGCGG + Intergenic
947058535 2:226135724-226135746 CAGTATCATCACGTGCAGGAGGG - Intergenic
947723017 2:232380680-232380702 CTCTGTCATCTCCATCAGGGAGG - Exonic
947727367 2:232408761-232408783 CTCTGTCATCTCCATCAGGGAGG - Exonic
947736507 2:232458055-232458077 CTCTGTCATCTCCATCAGGGAGG - Exonic
948217379 2:236241725-236241747 CTGTATCATCACAAAGAGGGTGG - Intronic
948373451 2:237505167-237505189 CTGCATCAGGACCAGCAAGGAGG - Intronic
948542006 2:238697757-238697779 CAGCATCATCCCCAGCAGGGAGG - Intergenic
1170170462 20:13405486-13405508 CAGAATAATCACCAGCAGTGTGG - Intronic
1172730394 20:37082211-37082233 CTGTATCATCACCAGCAGGGGGG - Intronic
1174212595 20:48891772-48891794 GTGTGTCATCCCCAGCAGGTGGG - Intergenic
1175221858 20:57421760-57421782 CTACATCAACACCTGCAGGGAGG - Intergenic
1175799350 20:61792259-61792281 CTGTCACCTCAACAGCAGGGTGG - Intronic
1178875082 21:36408056-36408078 CTGTTTCATATCCACCAGGGAGG - Intronic
949695282 3:6687329-6687351 CTGTTTCATCATGAGCAGAGAGG + Intergenic
950750828 3:15126823-15126845 GTGTGTCATCACCTGCAGGTGGG - Intergenic
956296946 3:67725216-67725238 CTGTATCATCAGCCCCAGGCAGG - Intergenic
958095756 3:88942320-88942342 CAGTATCATCAACAGCATGGTGG + Intergenic
961283473 3:125781578-125781600 GTGTGTCATCACCTGCAGGTGGG - Intergenic
961674457 3:128555986-128556008 CTGTGTCAACTCCAGCTGGGGGG + Intergenic
961807579 3:129500403-129500425 CTGTTTCATCATCTGCAAGGTGG - Intronic
963614044 3:147511952-147511974 CTGTACCCTCACCAGTATGGGGG + Intergenic
963772732 3:149405313-149405335 CTGTTTCCTCACCTGCAGGATGG + Intergenic
968576145 4:1367060-1367082 CTGTGGCATCACCAGCGGTGAGG - Intronic
968934839 4:3604620-3604642 CTGCCTCAGAACCAGCAGGGAGG - Intergenic
968992675 4:3925223-3925245 CTGTATCATGCCCTGCAAGGGGG + Intergenic
969029649 4:4201605-4201627 CTGTTTCATCATCAGTGGGGTGG - Intronic
969739740 4:9015757-9015779 GTGTGTCATCACCTGCAGGTGGG - Intergenic
969798905 4:9547301-9547323 GTGTCTCATCACCTGCAGGTGGG - Intergenic
972874229 4:43338659-43338681 CTAGATCATCACCAGCTGGCTGG - Intergenic
973697857 4:53508228-53508250 CTGTAACAGAACCAGCGGGGAGG + Intronic
977351910 4:95898986-95899008 ATGTATTATCATCAGGAGGGAGG + Intergenic
978564924 4:110071577-110071599 CAGTTTCAGAACCAGCAGGGGGG + Intronic
982478419 4:155879578-155879600 CCCTCTCATCACAAGCAGGGAGG - Intronic
983143736 4:164187268-164187290 CTGGAACATCTCCAGGAGGGGGG - Intronic
984592755 4:181635141-181635163 CTGCATCAGCAGCAGAAGGGAGG + Intergenic
986257752 5:6114759-6114781 CTGTACCAGCACCTGCAGGATGG + Intergenic
990237225 5:53781321-53781343 TTGTATCAGCACCCTCAGGGAGG + Intergenic
990837632 5:60040283-60040305 TTGTCACATCACCAGCAGGATGG + Intronic
990876687 5:60494308-60494330 CTGTAGCTGCACCAGCAGAGGGG - Intronic
991927465 5:71719334-71719356 AGGTAGCATCAGCAGCAGGGCGG - Exonic
994747254 5:103693634-103693656 CTCTATCACCACCAGGAAGGAGG - Intergenic
997916572 5:137932662-137932684 CTTTATCAGCAGCAGCAGTGAGG - Intronic
1002935954 6:1672662-1672684 CTGTTTCATCACCACCAGACTGG + Intronic
1008565636 6:52765503-52765525 CTCTATCAGCACCAGTAGGGAGG + Intergenic
1008569826 6:52805842-52805864 CTCTATCAGCACCAGTAGGGAGG + Intergenic
1008579847 6:52897033-52897055 CTCCATCAGCACCAGCATGGAGG + Intronic
1008611010 6:53184401-53184423 CTGTCTCCTGAGCAGCAGGGAGG - Intergenic
1008699342 6:54080035-54080057 CTCTGGCATCACCAGCAGTGGGG + Intronic
1008942674 6:57063981-57064003 CTGTGTGCTCACCACCAGGGAGG - Intergenic
1009235558 6:61119375-61119397 ATGTATCATCACCAGGCGAGTGG + Intergenic
1013410237 6:109877208-109877230 GTGTTTCAGCCCCAGCAGGGAGG - Intergenic
1013562711 6:111321599-111321621 CTGTTTCATTACCAGCCGGTGGG - Intronic
1023986440 7:45099894-45099916 CTGTATCAGCCCCAGCAGGCAGG - Intergenic
1029072904 7:97914293-97914315 GTGTGTCATCACCTGCAGGTGGG + Intergenic
1035068133 7:156122636-156122658 CTATCTCATCATCAGCAGGTGGG + Intergenic
1035133801 7:156679755-156679777 CTGGATTATGAACAGCAGGGCGG - Exonic
1036255961 8:7206739-7206761 GTGTCTCATCACCTGCAGGTAGG + Intergenic
1036361527 8:8080760-8080782 GTGTCTCATCACCTGCAGGTAGG - Intergenic
1036889445 8:12586263-12586285 GTGTCTCATCACCTGCAGGTAGG + Intergenic
1036897049 8:12644456-12644478 GTGTGTCATCACCTGCAGGTAGG + Intergenic
1039975803 8:42363878-42363900 CTGTATAAACACCAACAGGAAGG + Intronic
1040377776 8:46843052-46843074 CTGTAGCATCATCAGCAGCTGGG - Intergenic
1040545398 8:48394867-48394889 CTGTATCATCTCCTCCTGGGAGG + Intergenic
1041197595 8:55416623-55416645 CTGGAGGATCACAAGCAGGGGGG + Intronic
1045528445 8:102961556-102961578 CTCTATCGCCACCAGCAGGTGGG - Intronic
1049698105 8:143993476-143993498 CTGTGTCTCCATCAGCAGGGAGG - Intronic
1049867010 8:144945904-144945926 CTGTGTCATCACAGGTAGGGAGG - Intronic
1050362208 9:4840891-4840913 CTGGATCATGACCCGCAGAGAGG + Intronic
1053337340 9:37287032-37287054 CTGTTTCAACAACAGCAGAGAGG - Intronic
1054455336 9:65427358-65427380 CTGCCTCAGAACCAGCAGGGGGG + Intergenic
1056181995 9:84093969-84093991 CTGTATCATGACCAGGTGGCTGG + Intergenic
1056841558 9:90001996-90002018 CGGGATCATTTCCAGCAGGGCGG + Intergenic
1061289315 9:129641808-129641830 CTTTATCACCACAAGCCGGGCGG - Intronic
1061434386 9:130551855-130551877 GTATATCATAACCAGCAGGCCGG + Intergenic
1062178962 9:135180470-135180492 CTGCTTCCTCACCAGCAGGAGGG - Intergenic
1186299395 X:8183097-8183119 ATTTACCCTCACCAGCAGGGTGG + Intergenic
1187009033 X:15261213-15261235 CATTATCAGCACCAACAGGGTGG - Intronic
1191024066 X:55894632-55894654 CTGTCACAGCACCAGCAAGGTGG - Intergenic
1196192019 X:112804835-112804857 CTGCATAATCCCCAGAAGGGAGG - Intronic
1197366167 X:125567171-125567193 GTGTCCCATCCCCAGCAGGGAGG + Intergenic