ID: 1172731398

View in Genome Browser
Species Human (GRCh38)
Location 20:37091797-37091819
Sequence TGCAATAATCTAAAAGGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 135}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172731391_1172731398 18 Left 1172731391 20:37091756-37091778 CCAAACCCTAGAAGGATAAAAAG 0: 1
1: 0
2: 2
3: 19
4: 234
Right 1172731398 20:37091797-37091819 TGCAATAATCTAAAAGGGGTGGG 0: 1
1: 0
2: 0
3: 6
4: 135
1172731393_1172731398 12 Left 1172731393 20:37091762-37091784 CCTAGAAGGATAAAAAGATTGAT 0: 1
1: 0
2: 4
3: 47
4: 374
Right 1172731398 20:37091797-37091819 TGCAATAATCTAAAAGGGGTGGG 0: 1
1: 0
2: 0
3: 6
4: 135
1172731392_1172731398 13 Left 1172731392 20:37091761-37091783 CCCTAGAAGGATAAAAAGATTGA 0: 1
1: 0
2: 0
3: 27
4: 341
Right 1172731398 20:37091797-37091819 TGCAATAATCTAAAAGGGGTGGG 0: 1
1: 0
2: 0
3: 6
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172731398 Original CRISPR TGCAATAATCTAAAAGGGGT GGG Intronic
901544990 1:9949354-9949376 TGTTATAATCTATAAGGGGGAGG + Intronic
903009376 1:20319285-20319307 TGCAAGATTCTCACAGGGGTGGG - Intronic
908701763 1:66909949-66909971 TGCAATAATCCAAGAGAGATAGG - Intronic
911428898 1:97757999-97758021 TGAGATAATCAAAAAGGGGCAGG - Intronic
911731743 1:101298673-101298695 GGGAATAATCTGAAAGGAGTGGG + Intergenic
913244542 1:116860108-116860130 AGCAATAATCTGAATGAGGTAGG - Intergenic
918122846 1:181555171-181555193 TTTAAAAATCTAAAAGGGGGAGG - Intronic
923198822 1:231692467-231692489 TGCCATCTCCTAAAAGGGGTGGG - Intronic
1066707308 10:38194869-38194891 GGAAATAATTTAAAATGGGTGGG + Intergenic
1068873044 10:61965815-61965837 GGCCATAATCTCAAAGAGGTAGG + Intronic
1072569456 10:96645838-96645860 TGAAATAAACTAAAAAAGGTGGG - Intronic
1076706594 10:132305578-132305600 TGCACCAACCTGAAAGGGGTGGG + Intronic
1083149296 11:60781833-60781855 TCCCCTAATCTAGAAGGGGTTGG - Intergenic
1083350190 11:62022501-62022523 TGTAAAAATCCAAAAGGGCTGGG + Intergenic
1085927690 11:81040750-81040772 AGAAATCATCTAAAAGAGGTAGG - Intergenic
1088407205 11:109495166-109495188 TGCAGTAATCAAGATGGGGTAGG + Intergenic
1093475619 12:19551153-19551175 TGCAATATTCTGAAAGATGTTGG - Intronic
1093619854 12:21276445-21276467 TGCAATAATTTATAAGGGAGGGG + Intronic
1094480647 12:30878825-30878847 TGACATAATTTAAAGGGGGTTGG - Intergenic
1100849091 12:98690767-98690789 TGCCATAAAATAAAAGGGTTAGG - Intronic
1105567124 13:21560675-21560697 TGCAATAATCCCAATGGGGTAGG - Intronic
1111397930 13:87692146-87692168 TGCAACAAGCCAGAAGGGGTTGG + Exonic
1112802411 13:103126952-103126974 GCCAATAACCTACAAGGGGTTGG + Intergenic
1117213380 14:53525288-53525310 TGCAATTATCAAAAAAGTGTGGG - Intergenic
1119568205 14:75646696-75646718 TCCCATAACCTAAAAGGGGGTGG - Exonic
1120787873 14:88553525-88553547 TGCAATAATATGAAAGTGATTGG + Intronic
1121234021 14:92379466-92379488 TGGAATAATCTAGGAGGGGAAGG + Intronic
1123158436 14:106252939-106252961 TGCAAGAATCACAAAGGGGAAGG - Intergenic
1125248312 15:37669368-37669390 TGAAATAATTTTAAAGGGGAAGG + Intergenic
1126744382 15:51811397-51811419 TGCACAACTCTAAAAGGGGGAGG - Exonic
1127958916 15:63876533-63876555 AGAAATAATGTGAAAGGGGTAGG - Intergenic
1130415163 15:83686893-83686915 TAAAATAAGCTAAAAGGGGTGGG + Intronic
1133072516 16:3255947-3255969 TGCAATCATATGAACGGGGTTGG - Intronic
1134612575 16:15621622-15621644 TGCAATCATCACAAGGGGGTGGG + Intronic
1135958079 16:26973010-26973032 AGCAATAATCCAAAATGGATTGG - Intergenic
1136628221 16:31474494-31474516 TGGAATTGTCTAGAAGGGGTTGG - Intronic
1143963965 17:10742721-10742743 AGCAGGAATCTAAAAGCGGTGGG - Intergenic
1144658593 17:17053635-17053657 TGCAGTAACCTAAGAGGGATGGG - Intronic
1144992432 17:19242883-19242905 TGCAACTACCTAAGAGGGGTGGG - Intronic
1151444559 17:74154701-74154723 TGAAAAAATCTTAAAGGGGCCGG + Intergenic
1155720396 18:29004000-29004022 TAAAATAATCTAAAAGATGTTGG + Intergenic
1156708584 18:39913827-39913849 TTCAATAAGCTAAAAGGGTGAGG - Intergenic
1157052624 18:44185006-44185028 TGGAATCCTCTAAAAGGAGTAGG - Intergenic
1160277623 18:77452136-77452158 TTCTATAATTTGAAAGGGGTTGG + Intergenic
1160306182 18:77739965-77739987 TGTAATAATATAAAAGCGGAGGG + Intergenic
925786056 2:7432056-7432078 TGCATTAATCTCATCGGGGTTGG + Intergenic
928682541 2:33717150-33717172 TGCAATAGTCAGAAAAGGGTAGG - Intergenic
930046978 2:47181065-47181087 TGGTATAGTCTAGAAGGGGTAGG + Intergenic
931758196 2:65393139-65393161 TGCAGGAGTCTAAAAGTGGTTGG - Intronic
932122281 2:69112891-69112913 TGCCATAATCTAGAATGGTTGGG + Intronic
932273993 2:70437717-70437739 ACCAATAATCTAAAAGGAGGGGG - Intergenic
933025001 2:77245171-77245193 GGCAATAATCTACAAGGGCAAGG + Intronic
933320247 2:80765715-80765737 TGCAATAATTTAATAGGCATTGG + Intergenic
934899981 2:98151918-98151940 TGAAATAATCCAAAAGGATTTGG + Intronic
935487937 2:103681143-103681165 TGCATATATCTAAATGGGGTGGG - Intergenic
936792930 2:116171190-116171212 TGTTATAATTTAAAAAGGGTAGG - Intergenic
938591506 2:132741240-132741262 TGCAAAAATCTAGAAGTGTTTGG - Intronic
942987564 2:182161362-182161384 TGGAATTATCTAAATGGGGATGG + Intronic
944236771 2:197448195-197448217 TAAAATAACCCAAAAGGGGTTGG - Intergenic
945367609 2:208975223-208975245 TGAGAGAATCTAAAATGGGTGGG - Intergenic
946786599 2:223251750-223251772 TGCAATAAGCTAAATGAGTTTGG - Intergenic
1170859304 20:20088005-20088027 TGCAATAATTTACAAAAGGTAGG - Intronic
1171939255 20:31308689-31308711 TGCAGTGAACTAAAAGGGATGGG + Intergenic
1172695368 20:36818955-36818977 TGCATTTATCTAACAGGAGTGGG - Intronic
1172731398 20:37091797-37091819 TGCAATAATCTAAAAGGGGTGGG + Intronic
1173599688 20:44284871-44284893 AGCAATACTGTAAAAGGGATGGG - Intergenic
1177501624 21:21964254-21964276 TGCAATATTCTGAGAGGGGGTGG - Intergenic
1179037270 21:37769325-37769347 TGTATAAAACTAAAAGGGGTGGG - Intronic
1179272152 21:39859904-39859926 TGCAATAATCATAAAAGGGCAGG - Intergenic
1180033244 21:45226775-45226797 GTCAAGAATCTAACAGGGGTGGG - Intergenic
950910654 3:16586751-16586773 TGTAATAATCTAAAATGGTGGGG - Intergenic
952627783 3:35427771-35427793 TTCAATAATATAAAATGGCTAGG + Intergenic
953924595 3:46976140-46976162 TGCAAAAATCAAAAAGAGGCCGG - Intronic
955473148 3:59307832-59307854 TTAAATTTTCTAAAAGGGGTGGG + Intergenic
956747553 3:72321646-72321668 TGCAGCAATTTAAAAGGAGTGGG + Intergenic
959619863 3:108388393-108388415 AGCAATAATTGAAAAGAGGTGGG - Intronic
964799962 3:160545570-160545592 TGCAATGAACAAAGAGGGGTAGG + Intronic
965218266 3:165893022-165893044 TGAAATAATTTTGAAGGGGTGGG - Intergenic
965566799 3:170128253-170128275 TGCATAAAACTAAAAGGGTTAGG + Intronic
965635222 3:170773829-170773851 TGAAATGACCTAAAAGGGCTTGG + Intronic
965759246 3:172057512-172057534 TCCAAAAAAGTAAAAGGGGTTGG + Intronic
967941412 3:194769219-194769241 ATCAATCATCTACAAGGGGTGGG - Intergenic
967941435 3:194769333-194769355 ATCAATCATCTACAAGGGGTGGG - Intergenic
973070356 4:45850652-45850674 TGCAATAATCTGAATAGGATTGG - Intergenic
973971646 4:56218811-56218833 TGCAATCATCTAAAAGCCTTTGG - Intronic
974666037 4:64962842-64962864 AGCAATAATCAGAAAGTGGTTGG - Intergenic
976335823 4:83884984-83885006 TGCAATAATCAAAAGGAGGGTGG - Intergenic
977102646 4:92836845-92836867 TGTAATAATCTAATAGGTGGGGG + Intronic
977958158 4:103054112-103054134 TGCAAAAATAAAAAAGGTGTAGG + Intronic
978914134 4:114102855-114102877 AGAAATAATATAAAAGGGCTGGG + Intergenic
980898253 4:138880040-138880062 TGAAATATTATACAAGGGGTTGG + Intergenic
981820604 4:148882335-148882357 TGCAATGATATCTAAGGGGTGGG + Intergenic
983044812 4:162973612-162973634 TGCAAGAATCTAAAAGGTCAGGG + Intergenic
983506338 4:168557590-168557612 TGGAATAAGTTTAAAGGGGTAGG - Intronic
984042775 4:174757062-174757084 TGCAATAAGGTAAGAGGGATTGG + Intronic
984367906 4:178821977-178821999 TGGAAGAATCAAAAAGGGATGGG - Intergenic
984369427 4:178843195-178843217 TGAAATAATTCAAAAAGGGTTGG + Intergenic
987135970 5:14899712-14899734 TGCAATAAAAAAAAAGGGGCTGG + Intergenic
989792516 5:45422772-45422794 TGCAGAAATATAAAAGGGGTGGG - Intronic
990832845 5:59979694-59979716 TGAAATAATCTAAAAGTGCCCGG + Intronic
993094493 5:83465683-83465705 AGCAATAAGCTAAAAGATGTAGG - Intergenic
994022403 5:95042912-95042934 TATAATAGTATAAAAGGGGTGGG - Intronic
995708653 5:115012259-115012281 AGCAATAATAAAAAAGTGGTTGG + Intergenic
998300281 5:141011904-141011926 GGCATTAATATAAAAGAGGTAGG + Exonic
998540342 5:142975248-142975270 AGCTTTAATATAAAAGGGGTAGG + Intronic
1000872697 5:166596968-166596990 TGCTATAATGTAAAAGAGTTAGG + Intergenic
1002696652 5:181096910-181096932 TGCAACCATTTAAAAGGGGAGGG - Intergenic
1002697970 5:181102463-181102485 TGCAACCATTTAAAAGGGGAGGG + Intergenic
1004327695 6:14690752-14690774 TGGAATTATTTAAAAGGAGTGGG + Intergenic
1004591547 6:17056455-17056477 TGGAATAATCTTCATGGGGTGGG - Intergenic
1006214084 6:32423895-32423917 TGCAAAAATCTACAAGGCTTTGG + Intergenic
1009657296 6:66563370-66563392 TGCAAGAAACAAAAAGGGATGGG - Intergenic
1010548824 6:77194044-77194066 TGCCATAATGCAAAAGGTGTAGG - Intergenic
1012068712 6:94583440-94583462 TTCATCAATCTAAAAGGGGATGG - Intergenic
1013011981 6:106128994-106129016 TGCACAAATCTAAAAGGGTAGGG + Intergenic
1013975789 6:116077078-116077100 TTCATTAATCTAAATGTGGTAGG - Intergenic
1014402483 6:121007728-121007750 GGCAAACATCTAAAAGAGGTAGG + Intergenic
1020785208 7:12565223-12565245 TGCAATTCACTAAAATGGGTTGG - Intergenic
1022764077 7:33390457-33390479 TTCATTAATCTAAAAGGAATGGG - Intronic
1024441963 7:49430181-49430203 TGCAAATATCTAAAAGTGGTTGG - Intergenic
1024745057 7:52396707-52396729 TGCAATAGTGTCAAAGGAGTTGG + Intergenic
1024981819 7:55163682-55163704 TGCAATAATGTCTCAGGGGTGGG + Intronic
1032999481 7:137487836-137487858 TGAAATAATAAAAAAGGTGTAGG - Intronic
1041313102 8:56536302-56536324 TGCAATCTTCTAAATGGTGTGGG + Intergenic
1043288362 8:78563881-78563903 TGGAATAATCTATAAGGAGTAGG + Intronic
1043521534 8:81051438-81051460 TGCAATAAGCCAAAAAAGGTGGG - Intronic
1044391976 8:91662328-91662350 TTCACAAACCTAAAAGGGGTAGG - Intergenic
1050755109 9:8992684-8992706 TGCAATATTTTGAAAGGTGTAGG - Intronic
1053118317 9:35525177-35525199 AGAAATAATCTACCAGGGGTAGG + Intronic
1053709366 9:40789937-40789959 TTAAATATTCTAAAAGTGGTCGG - Intergenic
1054419274 9:64910740-64910762 TTAAATATTCTAAAAGTGGTCGG - Intergenic
1059777992 9:117495488-117495510 TGACATCAACTAAAAGGGGTGGG + Intergenic
1185686111 X:1930014-1930036 TGTAATAATTTAAAATGGGCTGG + Intergenic
1186724430 X:12342211-12342233 TTCCATAATCTAAAAGAGGAAGG + Intronic
1187247111 X:17562570-17562592 TGCTATAATCACAAAGGGGTGGG + Intronic
1194168362 X:90551097-90551119 TGGAATAATCTCAAAAGGATTGG - Intergenic
1196494015 X:116302524-116302546 TGTAAAAATCTAAAAACGGTGGG - Intergenic
1196577854 X:117341184-117341206 TGCAATAAACATAAAGGTGTAGG - Intergenic
1197494068 X:127155162-127155184 TGACATAAACTAAAGGGGGTAGG - Intergenic
1198625724 X:138571131-138571153 TGCATTAATCTGCAAGTGGTTGG + Intergenic
1200426347 Y:3024801-3024823 TACAAAAATATAAAAGGGGCTGG - Intergenic
1200514608 Y:4128875-4128897 TGAAATAATCTCAAAAGGATTGG - Intergenic