ID: 1172737523

View in Genome Browser
Species Human (GRCh38)
Location 20:37138837-37138859
Sequence CATCATCAGCACCAGTAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 187}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172737520_1172737523 -4 Left 1172737520 20:37138818-37138840 CCACTTAATATAAAATGGCCATC 0: 1
1: 0
2: 0
3: 12
4: 152
Right 1172737523 20:37138837-37138859 CATCATCAGCACCAGTAGGCTGG 0: 1
1: 0
2: 1
3: 8
4: 187
1172737518_1172737523 2 Left 1172737518 20:37138812-37138834 CCTCAACCACTTAATATAAAATG 0: 1
1: 0
2: 1
3: 20
4: 303
Right 1172737523 20:37138837-37138859 CATCATCAGCACCAGTAGGCTGG 0: 1
1: 0
2: 1
3: 8
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172737523 Original CRISPR CATCATCAGCACCAGTAGGC TGG Intronic
900421874 1:2559284-2559306 CATCCTCAGCCCAAGTAGACAGG - Intronic
902457854 1:16548642-16548664 CACACTCAGCACCAGTAGGTTGG - Intergenic
902494305 1:16859271-16859293 CACACTCAGCACCAGTAGGTTGG + Intronic
904396856 1:30228012-30228034 CATCAACAGCACTAGGATGCCGG + Intergenic
906094783 1:43215281-43215303 CATCCTCAGCAGCAGTCAGCAGG - Intronic
906684154 1:47752240-47752262 CTTCATGCTCACCAGTAGGCAGG + Intergenic
906943731 1:50277835-50277857 CATCCTCAGAACCAGCAGCCAGG + Intergenic
909354026 1:74686389-74686411 CAACATCAGCCCCTGTAGGTGGG + Intergenic
910515409 1:88054594-88054616 AATAATCAGCAGCAGTAGCCAGG - Intergenic
912873149 1:113328237-113328259 AATAATCAGCAGCAGTAGCCAGG - Intergenic
913126142 1:115792190-115792212 CTTCATCAGCAGCTGGAGGCAGG - Intergenic
916899145 1:169201832-169201854 CTTAACCACCACCAGTAGGCTGG - Intronic
917789445 1:178490172-178490194 CATCATCGGCACCTGCAGCCAGG + Intergenic
921213685 1:212920185-212920207 CATCATCATAACCAGAAGCCCGG - Intergenic
921420248 1:214938839-214938861 CAACATCAGGACCATTAGTCTGG + Intergenic
922388565 1:225114148-225114170 AATAATCAGCAACAGTAGCCAGG - Intronic
922686089 1:227639715-227639737 CTGCCTCTGCACCAGTAGGCTGG + Intronic
922857825 1:228790222-228790244 CTTCTTCAGCCCCACTAGGCAGG + Intergenic
924679864 1:246220616-246220638 CATGAACAGCAGCAGGAGGCAGG + Intronic
1064645341 10:17454199-17454221 CAGCAGCAGCAGCAGCAGGCTGG + Exonic
1066551081 10:36557835-36557857 CATCATCAGCAGCACTAAGAAGG - Intergenic
1067769134 10:49110936-49110958 CACCTTCAGCACCAGGAGGTGGG + Intronic
1070779457 10:79129263-79129285 CAGCATCAGCCCCACTAGGGTGG + Intronic
1072779535 10:98237678-98237700 CAGCCTCAGCACCAATAGGTAGG - Intronic
1073181432 10:101585857-101585879 CATCTTCATCCCCAGTAGGTGGG - Exonic
1073505406 10:103983776-103983798 TAACACCAGCACCAGTTGGCTGG + Intronic
1074014946 10:109525306-109525328 CTTCATCAGCACCAGAGGGATGG + Intergenic
1074835081 10:117283966-117283988 CAGCATCAACACGAGGAGGCAGG + Exonic
1075091662 10:119447240-119447262 CTTCATCAGAACCACGAGGCAGG - Intronic
1075437388 10:122455108-122455130 CATCAGAAGCACCTGAAGGCTGG - Intronic
1075450939 10:122551625-122551647 CAGCATGAGCAACAGGAGGCAGG - Intergenic
1076610741 10:131724528-131724550 CATCATAAGCATCAGATGGCGGG - Intergenic
1079259415 11:18863993-18864015 CAGAATCAGCACCACTAGACAGG + Intergenic
1082099144 11:48157485-48157507 CATCAGCATCACCAGGAGGGTGG + Intronic
1083811759 11:65110410-65110432 CATCCTCAGCACCGATGGGCTGG + Intronic
1084213760 11:67635731-67635753 CTTCAGCAGCACCGGGAGGCAGG - Intronic
1086419852 11:86628055-86628077 AATCATCTGCACCAGAGGGCAGG - Intronic
1089871881 11:121682247-121682269 CAGCATCAGCAGAAGTAAGCAGG + Intergenic
1092611211 12:10175096-10175118 GATCATGAACACCAGGAGGCAGG - Intronic
1093684353 12:22039612-22039634 AAGCAGCAGCACAAGTAGGCAGG + Intergenic
1095579070 12:43774779-43774801 CATCATCAGGAAAAGTAGGAGGG + Intronic
1096524039 12:52200223-52200245 TCTCCTCAGCACCAGCAGGCAGG + Intergenic
1098321707 12:69251236-69251258 CATCATCACCAACAGTTGGTGGG - Exonic
1098736606 12:74112875-74112897 AATAATCAGCAGCAGTAGCCAGG - Intergenic
1103005404 12:117416642-117416664 CAGCATCAGCATCAGCAGTCAGG + Intronic
1104048034 12:125177198-125177220 CATCATCAGCTCTAATAGCCTGG + Intergenic
1104613936 12:130253277-130253299 TAACATCAGCACAAGGAGGCAGG + Intergenic
1106396977 13:29390745-29390767 CATCATCATCACCATTTGGTGGG - Intronic
1106599407 13:31174977-31174999 CATCATCCTCACCAGTAGCTTGG - Intergenic
1106758132 13:32842628-32842650 AGTCATCAGTACCAGGAGGCAGG - Intergenic
1107986937 13:45783906-45783928 CACCTTCACCACCAGGAGGCGGG - Exonic
1108313374 13:49217009-49217031 CATTATGTGCACCAGAAGGCAGG - Intergenic
1110448795 13:75618052-75618074 AATAATCAGCAGCAGTAGACAGG - Intergenic
1111354444 13:87080123-87080145 CGTGATCAGAACCAGGAGGCTGG + Intergenic
1113491186 13:110693328-110693350 CAGCACCAGCAGCAGTAGGTGGG - Intronic
1119013612 14:71024529-71024551 CATCATCAGCACCATAAGACAGG - Intronic
1122778671 14:104134499-104134521 CTTGACCAGCACCAGCAGGCTGG + Intergenic
1122827721 14:104379036-104379058 CATCATCACCAGCAATAGTCTGG + Intergenic
1129253438 15:74320832-74320854 CCTCATCACCACCAGAGGGCAGG - Intronic
1130652984 15:85772832-85772854 CAGCATCTGCATCAGCAGGCAGG - Intronic
1133834200 16:9351706-9351728 CATAATCAGCAACGGTAGCCAGG - Intergenic
1134642952 16:15843863-15843885 CATCATCATCACCCGGAAGCTGG - Intronic
1135537439 16:23304926-23304948 ACTCATCAGCATCAGTAAGCAGG + Intronic
1138435153 16:56994476-56994498 CCTCATCAGCTCCACAAGGCAGG - Intronic
1141853932 16:86668094-86668116 CTTCATCAGCCCCAGGAGGTAGG - Intergenic
1142148289 16:88501745-88501767 TATCATCAGCACCAGCGGGAGGG - Intronic
1147906467 17:43826373-43826395 CATCAGCATCACCTGGAGGCAGG + Intronic
1151691027 17:75685470-75685492 CATCATCGACACCGGTAGGAAGG - Intronic
1151895128 17:76974941-76974963 CATGAACAGCAGCAGGAGGCAGG + Intergenic
1151979344 17:77499397-77499419 CATCAGCAGCACCTGCAGCCCGG - Exonic
1152427484 17:80226040-80226062 CATCAGCAGCACCTGCAAGCTGG + Intronic
1153274931 18:3359253-3359275 CAGCATCAGCACCAGGTGGCTGG - Intergenic
1153363291 18:4224172-4224194 AATAATCAGCAGCAGTAGCCAGG + Intronic
1157243348 18:46032211-46032233 GATTATGAGCACCACTAGGCAGG - Intronic
1157414177 18:47488548-47488570 TAGCATCAGAACCAGTAGCCAGG - Intergenic
1160050444 18:75428476-75428498 CATCATGAGCTTCTGTAGGCTGG - Intergenic
1160059150 18:75514034-75514056 CATCAACAGCCCCAGGAGCCCGG + Intergenic
1161098118 19:2405498-2405520 CATCATCAACGCCAGGTGGCTGG + Exonic
1161807044 19:6450377-6450399 CATCTTCAGTAACAGTGGGCGGG - Intronic
1163768722 19:19178085-19178107 CATCCTCAGCCCCAAAAGGCAGG - Intronic
1165013029 19:32862476-32862498 CATCATCATCATCAGCGGGCTGG - Exonic
1165716282 19:38047866-38047888 CATCCTCAGCTCCAGTCAGCTGG + Intronic
1166105737 19:40597266-40597288 CAGCAACAGCACCAGCAGGAGGG - Exonic
1166648293 19:44549241-44549263 GATCAGCAGCACGAATAGGCTGG + Intergenic
925256932 2:2498434-2498456 CATAATAAGCACCAGTTGGGTGG + Intergenic
927010714 2:18900841-18900863 CAACATCACCACCAGCAGTCTGG - Intergenic
928325533 2:30316626-30316648 CACCATGAGCAGAAGTAGGCAGG - Intronic
934028320 2:88018844-88018866 CATGCTCAGCCCCAGTAGGAGGG + Intergenic
934038631 2:88109508-88109530 CATCAGCAGCACCATTTGCCAGG - Intronic
934165265 2:89288538-89288560 CTACATCAGCATCAGTGGGCTGG + Intergenic
934167088 2:89303788-89303810 CATGATCAGCACATGTGGGCTGG - Intergenic
934200189 2:89878666-89878688 CATGATCAGCACATGTGGGCTGG + Intergenic
934202009 2:89893924-89893946 CTACATCAGCATCAGTGGGCTGG - Intergenic
936511304 2:113149761-113149783 AATAATCAGCAGCTGTAGGCAGG - Intergenic
939121738 2:138125448-138125470 CTTCTTCAGCCCCAGTAGGAGGG + Intergenic
940802971 2:158153769-158153791 AATTATCAGCAGCAGTAGCCAGG + Intergenic
942461169 2:176169844-176169866 CAGCAACAGCACCAGCAGCCTGG - Intronic
944211541 2:197211194-197211216 CATCACCAGCACACGTGGGCAGG + Intronic
946496120 2:220197207-220197229 CACCAACAGAAGCAGTAGGCAGG + Intergenic
1169126949 20:3135837-3135859 CATTATCAGTATCAGTAGGCTGG + Intronic
1169127182 20:3137604-3137626 CATTACCAGTATCAGTAGGCTGG - Intronic
1169771063 20:9200982-9201004 GATCCTCAGCAGCAGAAGGCAGG + Intronic
1170864120 20:20137914-20137936 AATAATCAGCAGCAGTAGCCAGG - Intronic
1171461381 20:25299988-25300010 CAGCATCAGCAGCTGTGGGCTGG - Intronic
1172737523 20:37138837-37138859 CATCATCAGCACCAGTAGGCTGG + Intronic
1172872645 20:38145200-38145222 CATCCTCCACACCAGCAGGCTGG - Intronic
1173734815 20:45352422-45352444 CATCATCAGGACCAAGAGACAGG - Intergenic
1175574544 20:60050861-60050883 CATCATTAGCCCCAGTTAGCAGG - Intergenic
1179786731 21:43734536-43734558 CCTCCTCAGCTCCAGGAGGCAGG - Intronic
1180250334 21:46582019-46582041 CCTCTTCAGAACCAGCAGGCAGG + Intergenic
1181751140 22:24989999-24990021 CATTATGAGCACCAGACGGCAGG + Intronic
1182066932 22:27437693-27437715 CCACATCAACACCAGAAGGCAGG + Intergenic
1182115343 22:27753256-27753278 CACCATCAGCTCCAGGAGGAGGG - Intronic
1184027460 22:41868484-41868506 CATCATCTTCAGCAGTAGGTGGG + Intronic
949241974 3:1884005-1884027 CATCATCAACATCAGTTGGAAGG + Intergenic
949643853 3:6070659-6070681 CATCTTCATCATCAGCAGGCTGG + Intergenic
953930033 3:47001275-47001297 CAGCATCATCTCCAGGAGGCTGG - Exonic
954194853 3:48990432-48990454 CACCATCAGCACCAGGAAGTAGG - Exonic
954724520 3:52596505-52596527 AATAATCAGCAACAGTAGCCAGG - Intronic
960423531 3:117478105-117478127 AATCATCAGCATCAGTATGTAGG - Intergenic
960916003 3:122695529-122695551 AGTCATCAGCACCAGGTGGCAGG - Exonic
961319970 3:126065995-126066017 AAGCATCAGTACCAGGAGGCAGG - Intronic
962049750 3:131800601-131800623 CAACATCAGGAGCAGTAGGAGGG - Intronic
964572722 3:158127889-158127911 CCTCATCAGCACCATTTAGCAGG + Intronic
965014503 3:163139923-163139945 CATCTTCAGACCCACTAGGCTGG - Intergenic
965714778 3:171591221-171591243 CAACATGAACACCAGGAGGCAGG - Intergenic
967923921 3:194632145-194632167 CAATATCAGCACCAGGAGGTAGG - Intronic
971460373 4:26889660-26889682 CCTCATTAGCACCTGTAGCCAGG + Intronic
973759110 4:54100756-54100778 CATCATCAGCCCCAGCAGCCTGG + Exonic
974103246 4:57440377-57440399 GATCATCAGCACCAGTGCTCAGG - Intergenic
981566240 4:146104690-146104712 CATCCTCACCACCAACAGGCAGG + Intergenic
985982604 5:3483650-3483672 GAACATCAGCACCAGGAAGCAGG - Intergenic
988565947 5:32320249-32320271 CATGAACAGCAGCAGGAGGCAGG - Intergenic
989121992 5:38014191-38014213 CATCATTAGAACCAGTTGGCTGG - Intergenic
991223129 5:64238444-64238466 CATTATCATCAACAGTATGCAGG + Intronic
991577170 5:68116474-68116496 AATAATCAGCAGCAGTACGCAGG + Intergenic
995943342 5:117611789-117611811 GATCATGAGGACCAGGAGGCAGG - Intergenic
996841685 5:127853474-127853496 CATCAAAAGCACCTGGAGGCTGG + Intergenic
997831517 5:137154652-137154674 GTTCATCAGCACCAATGGGCTGG + Intronic
998282397 5:140823895-140823917 CAGCGTGAGCACCAGCAGGCTGG - Exonic
998284322 5:140843444-140843466 CAGCGTGAGCACCAGCAGGCTGG - Exonic
998287558 5:140877595-140877617 CAGCGTGAGCACCAGCAGGCTGG - Exonic
998983715 5:147731805-147731827 CATCCTCAGCCCCAGATGGCTGG - Intronic
1002065682 5:176650599-176650621 CATCAGCAGACCCAGCAGGCAGG + Intronic
1007166547 6:39832413-39832435 CATCATCACCACCACTAAGTGGG - Intronic
1007930841 6:45689245-45689267 CCTCATCCCCACCAGTAGCCAGG + Intergenic
1008565636 6:52765503-52765525 CTCTATCAGCACCAGTAGGGAGG + Intergenic
1008568912 6:52796075-52796097 CATCATGACCAGCAGCAGGCTGG - Intronic
1008569826 6:52805842-52805864 CTCTATCAGCACCAGTAGGGAGG + Intergenic
1008573375 6:52836129-52836151 CATCATGACCAGCAGCAGGCTGG - Intronic
1008575706 6:52858173-52858195 CATCATGACCAGCAGCAGGCTGG - Intronic
1008577273 6:52873243-52873265 CTCCATCAGCACCAGTATGAAGG + Intronic
1012756128 6:103232628-103232650 CATCTTTAGAACAAGTAGGCCGG - Intergenic
1013195080 6:107837764-107837786 TTTAATCAGAACCAGTAGGCAGG - Intergenic
1014810140 6:125875933-125875955 CATCATAAGCTCCTGGAGGCCGG + Intronic
1015041371 6:128724047-128724069 TAGAATGAGCACCAGTAGGCAGG + Intergenic
1015202415 6:130597908-130597930 CATGATCAGCTCCCATAGGCTGG - Intergenic
1016292221 6:142538358-142538380 CTGCCTCTGCACCAGTAGGCTGG - Intergenic
1019630987 7:2049702-2049724 CTTCATCAGCACCAGTGTCCAGG + Intronic
1020036273 7:4964999-4965021 CATCAACAGCACCTGTAGGCAGG + Intergenic
1020069489 7:5216798-5216820 CATGACCAGCATCAGTAGGAAGG - Intronic
1023395206 7:39745581-39745603 CATCTTCAGCATCACTGGGCAGG + Intergenic
1025606899 7:63045980-63046002 CATCATCTGTGCCAGTAGGCAGG - Intergenic
1026830162 7:73605785-73605807 CGACATCAGCAGCAGCAGGCAGG + Intronic
1033172197 7:139094055-139094077 CATCATCAGCATCACTTGGGAGG + Intronic
1034610639 7:152365212-152365234 CTTCAAAAGCAACAGTAGGCTGG + Intronic
1036558728 8:9883854-9883876 CCTAATCAGCAGCAGGAGGCAGG + Intergenic
1037177651 8:15966046-15966068 CATCTTCTGCACAAGGAGGCAGG + Intergenic
1037258891 8:16985145-16985167 AAGCATGAGCACCAGAAGGCAGG + Intergenic
1037869106 8:22474823-22474845 CATCCACAGCACCAGTACGTGGG - Intronic
1041636028 8:60145884-60145906 CTTTATCAGCACCCTTAGGCTGG - Intergenic
1042157927 8:65865041-65865063 CTACCTCTGCACCAGTAGGCCGG - Intergenic
1042846557 8:73174631-73174653 CATCATCAGCACTAATCGTCTGG + Intergenic
1043356752 8:79422820-79422842 CATCAGCAGCACCTGAGGGCTGG + Intergenic
1047210269 8:122834957-122834979 CTGCCTCCGCACCAGTAGGCTGG + Intronic
1047799257 8:128291964-128291986 CAGCAGCAGCACCACTAGGCTGG + Intergenic
1049164758 8:141119014-141119036 CATCGTCACCACCACTAGGGTGG + Intronic
1049364136 8:142228446-142228468 CTTCACCAGCTCCTGTAGGCAGG - Intronic
1049478579 8:142808232-142808254 CAGCAGCAGCAGCAGTGGGCTGG + Intergenic
1050145186 9:2560015-2560037 AATAATCAGCAGCAGTAGCCAGG + Intergenic
1053600187 9:39602458-39602480 CATGCTCAGCCCCAGTAGGAGGG - Intergenic
1053857841 9:42356314-42356336 CATGCTCAGCCCCAGTAGGAGGG - Intergenic
1054253339 9:62739926-62739948 CATGCTCAGCCCCAGTAGGAGGG + Intergenic
1054567456 9:66774425-66774447 CATGCTCAGCCCCAGTAGGAGGG + Intergenic
1054754272 9:68941400-68941422 CAACATCAGAAGCAGAAGGCAGG + Intronic
1058912534 9:109534180-109534202 CATCAGCAGCACCTGCCGGCGGG - Intergenic
1060304472 9:122398381-122398403 AATAATCAGCAGCAGTAGCCAGG + Intergenic
1060789753 9:126478245-126478267 CATCTCCAGCAGCAGCAGGCGGG + Intronic
1060803902 9:126563205-126563227 CATTACCAGCCTCAGTAGGCAGG + Intergenic
1062651398 9:137579513-137579535 GATTATCAGCACCAGTCGCCTGG + Intergenic
1187009033 X:15261213-15261235 CATTATCAGCACCAACAGGGTGG - Intronic
1187256560 X:17648329-17648351 CTTCATGAGCAGCAGTAAGCAGG + Intronic
1187371264 X:18708724-18708746 CATCATCAGCACAAGTCAGCTGG - Intronic
1187619345 X:21032570-21032592 CATCAACAGCAAAAATAGGCAGG + Intergenic
1198368912 X:135972783-135972805 CATCATGAGCACCACCTGGCAGG - Intronic
1200333278 X:155320151-155320173 TCTCTTTAGCACCAGTAGGCAGG - Intronic
1201988997 Y:20003846-20003868 CATCATAAAAACCAGTAAGCAGG + Intergenic