ID: 1172742332

View in Genome Browser
Species Human (GRCh38)
Location 20:37179032-37179054
Sequence GGCCTGGCCCAACCGCGTCC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 129}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172742325_1172742332 -3 Left 1172742325 20:37179012-37179034 CCGTCTCGGGCCCACCCCGAGGC 0: 1
1: 0
2: 1
3: 17
4: 152
Right 1172742332 20:37179032-37179054 GGCCTGGCCCAACCGCGTCCCGG 0: 1
1: 0
2: 0
3: 5
4: 129
1172742319_1172742332 13 Left 1172742319 20:37178996-37179018 CCAATCAGAAGCGGCCCCGTCTC 0: 1
1: 0
2: 0
3: 5
4: 63
Right 1172742332 20:37179032-37179054 GGCCTGGCCCAACCGCGTCCCGG 0: 1
1: 0
2: 0
3: 5
4: 129
1172742322_1172742332 -1 Left 1172742322 20:37179010-37179032 CCCCGTCTCGGGCCCACCCCGAG 0: 1
1: 0
2: 0
3: 1
4: 152
Right 1172742332 20:37179032-37179054 GGCCTGGCCCAACCGCGTCCCGG 0: 1
1: 0
2: 0
3: 5
4: 129
1172742323_1172742332 -2 Left 1172742323 20:37179011-37179033 CCCGTCTCGGGCCCACCCCGAGG 0: 1
1: 0
2: 0
3: 4
4: 131
Right 1172742332 20:37179032-37179054 GGCCTGGCCCAACCGCGTCCCGG 0: 1
1: 0
2: 0
3: 5
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172742332 Original CRISPR GGCCTGGCCCAACCGCGTCC CGG Exonic
900159871 1:1218431-1218453 GCCCTGGCGCAGCCGTGTCCCGG - Intronic
900586179 1:3433350-3433372 GGCCTGGCTCAACCTTGCCCTGG - Intronic
903545948 1:24123471-24123493 GGCCAGACCCAACCGGGCCCAGG - Intronic
903973277 1:27133034-27133056 GGCCTAGCCCAAGCCCGTCAGGG + Intronic
904837642 1:33349601-33349623 GGCCAGGCCCAGCCGGGCCCTGG - Intronic
912246269 1:107964881-107964903 GCCCCGGCCCAGCCGCGTCCCGG - Exonic
913521329 1:119648032-119648054 GGCTGGGCTCAACCGCCTCCCGG - Intergenic
914343881 1:146781811-146781833 GGCCTGCCCCCACCGCCTTCTGG - Intergenic
915069413 1:153253839-153253861 GCCCTGGCCCAACAGCCTACTGG + Intergenic
917755642 1:178094591-178094613 TGACTGGGACAACCGCGTCCAGG - Exonic
920364377 1:205440363-205440385 GGCCTGGCCCCACCTGGCCCAGG + Intronic
920673976 1:208026192-208026214 GGCCTGGCCCACACACCTCCAGG + Exonic
924208955 1:241745023-241745045 GGCCTAGCCCAACCTGGGCCTGG - Intronic
1065945955 10:30605681-30605703 GGCCTGGCCCGACAGTGACCAGG + Intergenic
1068879434 10:62032776-62032798 GTCCTGGCCAAACCAAGTCCTGG - Intronic
1070287988 10:75097719-75097741 GGTCTGGCCCAGCCTCTTCCTGG - Exonic
1070823289 10:79375684-79375706 TGCCTGGCCCTACAGCCTCCTGG - Intergenic
1070916998 10:80161334-80161356 GGACTGGCCCAAGCACCTCCCGG + Intronic
1074769959 10:116726717-116726739 GGCATGGCCCTACTGCCTCCAGG + Intronic
1076443453 10:130495999-130496021 TGGCTGCCCCAACCGTGTCCTGG - Intergenic
1076621280 10:131789741-131789763 GGCCTGGCCCAGCCTCCACCTGG - Intergenic
1077042630 11:531334-531356 GGCCTGGCCCAGCCTCAACCCGG + Intergenic
1077275682 11:1706477-1706499 GGCCTGGCCTGCCCCCGTCCTGG + Intergenic
1077414659 11:2419208-2419230 GGCCTGGCCAAACGGTGCCCGGG + Intronic
1079075302 11:17381975-17381997 GGACTGGCCAAACTGGGTCCAGG - Intergenic
1082050446 11:47766897-47766919 GGCCTGGCCCTTCTGCGGCCCGG + Intronic
1083159026 11:60843052-60843074 GGCCTGGCCCCACCCTCTCCGGG - Intronic
1084742139 11:71146709-71146731 GGCCTGGCCCTGCCTCTTCCTGG - Intronic
1087261098 11:96013571-96013593 GGCCTGCCACAACCCCATCCTGG + Intronic
1091750914 12:3020764-3020786 GGCCAGGACCTACCGTGTCCGGG - Exonic
1092487416 12:8914589-8914611 GGCCTGGCTGAGCCGCGGCCGGG + Exonic
1092737044 12:11592615-11592637 AGCCTGGCCCCACCTGGTCCGGG - Intergenic
1096946756 12:55415052-55415074 GGCCTGGCTGAGCCGCGGCCGGG - Intergenic
1102886441 12:116525583-116525605 GTCTTGGCCCAAACCCGTCCCGG - Intergenic
1102990159 12:117309622-117309644 GGCCTGGCCCATCAGCTTACTGG + Intronic
1106776870 13:33017055-33017077 CGGCTGGGCCAACCGCGCCCTGG + Exonic
1121047573 14:90799283-90799305 GGCCTGGGCCATCAGGGTCCTGG + Intronic
1122419810 14:101568434-101568456 GGCCTGGCCTCCCCGCCTCCAGG - Intergenic
1122855968 14:104560277-104560299 GGCCTGGCTCCTCCTCGTCCAGG + Intronic
1122930045 14:104928942-104928964 GCCCTGGCCCCACCGCATCCTGG + Intronic
1122986411 14:105213729-105213751 GGCCTGGCACAGCTGCTTCCTGG - Intronic
1125568463 15:40695470-40695492 GTCCTCGCCCACCTGCGTCCTGG + Intronic
1127356427 15:58205193-58205215 GGCTTGGCCCAACACAGTCCTGG + Intronic
1127917572 15:63467738-63467760 TGCCTGGCCCAGCAGCCTCCAGG + Intergenic
1128462897 15:67884687-67884709 GGCTGGGCCCCAGCGCGTCCTGG - Intergenic
1129188434 15:73924263-73924285 GGCCTGGCCCAGCCACTCCCCGG - Intergenic
1130137643 15:81195368-81195390 GTCCTGGCCCCACCGCACCCAGG + Intronic
1131054524 15:89367747-89367769 GGCCTGCCTCGACGGCGTCCCGG - Intergenic
1137501190 16:49013031-49013053 GGCCTGGCTCAACCCAGGCCTGG - Intergenic
1138353259 16:56357937-56357959 GGCTGGGCCCAAGCTCGTCCTGG - Intergenic
1138598609 16:58042248-58042270 AGTCCGGCACAACCGCGTCCTGG + Exonic
1139990112 16:70933524-70933546 GGCCTGCCCCCACCGCCTTCTGG + Intronic
1141431839 16:83974241-83974263 GTCCTGGCTCAGCCGCGTACCGG + Intronic
1142112831 16:88341304-88341326 GCCCTGGCCCATGCGCCTCCTGG - Intergenic
1142209898 16:88804000-88804022 GGCCTGGCCTGGTCGCGTCCGGG - Exonic
1142244042 16:88960729-88960751 GGCCTGGGCCACCCGCCTCTGGG + Intronic
1146058519 17:29592959-29592981 GGCCTGGCCCAGACGCGGGCGGG - Intronic
1148158657 17:45437563-45437585 GCCCTGGCTCACCAGCGTCCCGG - Exonic
1148324645 17:46776229-46776251 GGCCTGGCCCATCTGCACCCTGG + Intronic
1149598022 17:57875436-57875458 GGCCAGGCCCAGCCCCCTCCCGG + Intronic
1150390078 17:64784962-64784984 GCCCTGGCTCACCAGCGTCCCGG - Intergenic
1151169980 17:72237695-72237717 GGCCTGACCCAAATGCTTCCTGG + Intergenic
1151715189 17:75827613-75827635 GCCCTGGCCCATCTGCCTCCTGG - Exonic
1151983545 17:77528271-77528293 GGCCTGGCCCATCCGCCTCTGGG - Intergenic
1151994092 17:77597750-77597772 GCCCTGGGCCAGCTGCGTCCTGG + Intergenic
1152613972 17:81329550-81329572 GGCCTGGGCCAGCCCCTTCCTGG - Intronic
1160436073 18:78853796-78853818 GGCCTGGCTCAACAGCCCCCAGG - Intergenic
1160777625 19:863211-863233 GGCCTGGATCGACAGCGTCCTGG + Exonic
1160790299 19:919947-919969 GGCCTTCCCCAGCCGCGCCCTGG + Exonic
1161343320 19:3754219-3754241 GGCCTGGGCCATGCGCGTGCTGG + Exonic
1162022664 19:7874707-7874729 GGCCCAGCCTATCCGCGTCCAGG - Intergenic
1162396514 19:10420642-10420664 GCCATGGCCCTACCGCGGCCGGG + Exonic
1162396574 19:10420814-10420836 GGCCTGGCCCTCCCGGGGCCCGG - Exonic
1162470725 19:10871025-10871047 GGCGTGGCCCAGCCGCGACGAGG - Intergenic
1163604312 19:18265774-18265796 TGCCTGGCTCAACCACATCCGGG - Exonic
1163807110 19:19405998-19406020 GGCCCGGCCGACCCGCGGCCCGG + Intronic
1164564410 19:29315692-29315714 GGCCAGGCCCAACCCCTCCCTGG + Intergenic
1166259012 19:41625268-41625290 GGCCTGGCCTGAGGGCGTCCTGG - Intronic
1167101654 19:47407487-47407509 GGTCTGGCCCACCGGGGTCCGGG + Exonic
1167265337 19:48480305-48480327 CGCCTCTCCCACCCGCGTCCCGG - Intronic
1167432404 19:49462015-49462037 CGCCTGGTCCGACCGCGGCCCGG + Exonic
1167503634 19:49860518-49860540 GGCCTGGCCCCACCCAGGCCTGG - Exonic
932398152 2:71462292-71462314 TGCCTGGCCCAGCCGCAGCCTGG - Intronic
934552011 2:95268451-95268473 GGCCTAGCCCTACCTCTTCCCGG + Intergenic
937263383 2:120600766-120600788 GGCCTGGCCTTACCCCTTCCTGG + Intergenic
946193794 2:218021665-218021687 GGCCTGGCCCCAGCGACTCCTGG - Intergenic
948598064 2:239093076-239093098 GGCCTCGCCCAGCGGAGTCCTGG - Intronic
949063489 2:241974998-241975020 CGCCTTGCCCAACCTCGGCCCGG + Intergenic
1168904604 20:1393039-1393061 GGCGTGGACCAACAGCGACCTGG + Exonic
1171784416 20:29449151-29449173 GGCCTGGCCCAGCCTGGCCCTGG - Intergenic
1172742332 20:37179032-37179054 GGCCTGGCCCAACCGCGTCCCGG + Exonic
1175310989 20:58011488-58011510 GGCCTGCTCCCACAGCGTCCTGG + Intergenic
1175875479 20:62227488-62227510 GGCCTGGCCCAGCGGCCCCCTGG - Intergenic
1176029740 20:63006160-63006182 GGCCTGGCCGAAGGGCGTCAAGG + Exonic
1179243785 21:39612946-39612968 GGCCTGGACCCAGCGCCTCCGGG + Intronic
1181025804 22:20126803-20126825 TGCCTGGCCAAGCCGCCTCCTGG - Intronic
1181064705 22:20299871-20299893 GCCCTGGCCGACCCACGTCCTGG - Intergenic
1184711167 22:46250298-46250320 GGCCCCGCCCCACCGCGGCCCGG + Exonic
1184758826 22:46533518-46533540 GGCCCGGCCCAATTGCGCCCCGG + Intronic
1185299669 22:50072818-50072840 GGCCTGGTCCTACCCCTTCCGGG + Intronic
950415843 3:12868798-12868820 GTCCTGGAGCAGCCGCGTCCTGG + Intronic
953747024 3:45583071-45583093 GCCCTGGCCCAACCCCTCCCAGG - Intronic
953860332 3:46538917-46538939 GGCCCTGCCCAACCACTTCCTGG + Intronic
954661713 3:52230102-52230124 GGCCTGGGCCCACCCCGACCTGG - Intronic
960870786 3:122247704-122247726 GGTCTGTCCCATCCGCGGCCTGG - Intronic
961512031 3:127409110-127409132 AGCCTGTCCCCACCGCTTCCAGG - Intergenic
963028470 3:140942468-140942490 GGCCAGGTCCAGCGGCGTCCGGG - Intronic
963601254 3:147380829-147380851 GGCCTGGCCCAGGCGCGCCCCGG + Intergenic
969320786 4:6411242-6411264 GTCCTGGCCCCACCACTTCCTGG - Intronic
969373896 4:6750585-6750607 GCCATGGCCCAACCCCTTCCTGG + Intergenic
969694617 4:8727665-8727687 GGCCTGGCCGAGCTGCTTCCTGG + Intergenic
969724544 4:8911447-8911469 GGCCTGGCCATGCCCCGTCCTGG - Intergenic
971265003 4:25089500-25089522 GTCCTGGCCCTGCCGCATCCGGG + Intergenic
975166859 4:71187192-71187214 GGCTCGGCCCCGCCGCGTCCCGG + Intergenic
980013494 4:127622882-127622904 GGCCAGGGACACCCGCGTCCAGG - Intergenic
985580347 5:692747-692769 GTCCTGACACCACCGCGTCCTGG - Intronic
985595005 5:784128-784150 GTCCTGACACCACCGCGTCCTGG - Intergenic
991999098 5:72417962-72417984 GGCCAGGCCCAACCACGCGCCGG + Intergenic
1018686452 6:166307887-166307909 GGCCTTGCCCAGCCGCGCGCGGG - Exonic
1019784871 7:2968958-2968980 GGCCTGGCCTAACCCTGTCGCGG - Intronic
1029207740 7:98879201-98879223 GGCCTGGGCCTTCGGCGTCCGGG + Intronic
1029420475 7:100469431-100469453 GGCCTGGCTCAACAGCCCCCAGG + Intronic
1029456103 7:100673398-100673420 GGCGTGGCCCAACCGGGAACTGG + Intergenic
1029456174 7:100673695-100673717 GGTCTCGCCCAGCCGGGTCCTGG + Exonic
1035734427 8:1877686-1877708 GGCCTGGCACCACCGAGACCTGG - Intronic
1038290210 8:26242343-26242365 GAAGTGGCCCAACCGCCTCCCGG - Intergenic
1039921306 8:41896257-41896279 CGCCGCGCCCCACCGCGTCCCGG + Intronic
1041044805 8:53879734-53879756 GGACTTGCCCAGCCACGTCCCGG - Intronic
1049495321 8:142928190-142928212 GGCCTGGCCCTACCCCATCTCGG + Intergenic
1060749150 9:126157460-126157482 GGCCTGGCCCCACCTGGCCCTGG - Intergenic
1061056639 9:128226186-128226208 GGCCAGGCCCAGCCCCGCCCAGG - Intronic
1062515034 9:136928782-136928804 GGCCTGGCCCAGCCGCCTCATGG + Intronic
1186457750 X:9723273-9723295 GGCCTAGCCCAGGCTCGTCCTGG + Intergenic
1188200466 X:27289250-27289272 GGTCGGCCCCAACCTCGTCCCGG - Intergenic
1199058958 X:143330413-143330435 GGCCTGGCCCCTCCTCTTCCTGG + Intergenic