ID: 1172744078

View in Genome Browser
Species Human (GRCh38)
Location 20:37193247-37193269
Sequence CACATGCCAGGTGCTGTTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1338
Summary {0: 1, 1: 1, 2: 39, 3: 189, 4: 1108}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172744078_1172744083 24 Left 1172744078 20:37193247-37193269 CCTAGAACAGCACCTGGCATGTG 0: 1
1: 1
2: 39
3: 189
4: 1108
Right 1172744083 20:37193294-37193316 GTGATTGATCTGAATTCTAAAGG 0: 1
1: 0
2: 2
3: 13
4: 165
1172744078_1172744082 -4 Left 1172744078 20:37193247-37193269 CCTAGAACAGCACCTGGCATGTG 0: 1
1: 1
2: 39
3: 189
4: 1108
Right 1172744082 20:37193266-37193288 TGTGGTAGGCACTGAAGTGAAGG 0: 1
1: 0
2: 0
3: 27
4: 248
1172744078_1172744085 30 Left 1172744078 20:37193247-37193269 CCTAGAACAGCACCTGGCATGTG 0: 1
1: 1
2: 39
3: 189
4: 1108
Right 1172744085 20:37193300-37193322 GATCTGAATTCTAAAGGGAGAGG 0: 1
1: 0
2: 1
3: 15
4: 200
1172744078_1172744084 25 Left 1172744078 20:37193247-37193269 CCTAGAACAGCACCTGGCATGTG 0: 1
1: 1
2: 39
3: 189
4: 1108
Right 1172744084 20:37193295-37193317 TGATTGATCTGAATTCTAAAGGG 0: 1
1: 0
2: 2
3: 21
4: 254

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172744078 Original CRISPR CACATGCCAGGTGCTGTTCT AGG (reversed) Intronic
900482998 1:2908387-2908409 CACTTGCCCTGTGCTGTTCCTGG + Intergenic
900927179 1:5713019-5713041 TACATCACAGGTGCTGTTGTAGG - Intergenic
900929961 1:5730203-5730225 TATGTGCCAGGTGCTATTCTAGG - Intergenic
901010774 1:6200570-6200592 CCAAAGCCAGCTGCTGTTCTTGG + Intronic
901125175 1:6924148-6924170 CACATGCCAGGCACTGTTCCCGG + Intronic
901132110 1:6968504-6968526 TGCGTGCCAGGTGCTGTGCTGGG + Intronic
901259863 1:7863584-7863606 CCAAGGCCAGGCGCTGTTCTAGG - Intergenic
901283252 1:8056284-8056306 TCCATTCCAGGTGCTTTTCTGGG + Intergenic
901567725 1:10132549-10132571 CACCTACCAGGCACTGTTCTAGG + Intronic
901933251 1:12610488-12610510 TATATGCCAGGCACTGTTCTGGG - Intronic
902099330 1:13972967-13972989 CACATGCCAGGAATTGTTTTAGG + Intergenic
902167197 1:14582068-14582090 TACATGTCAGATGCTATTCTAGG - Intergenic
902201864 1:14839389-14839411 TTTATGCCAGGTACTGTTCTAGG - Intronic
902220058 1:14958940-14958962 CAGGTGCCAGGTGCTGTTCTAGG + Intronic
902260896 1:15224048-15224070 TAGATGCCAGGTACTGCTCTAGG + Intergenic
902271651 1:15309329-15309351 TAGATGCCAGGCACTGTTCTAGG + Intronic
902379439 1:16045695-16045717 TCCATGGCAGGTGCTGCTCTGGG + Intronic
902385138 1:16072091-16072113 CCCGTACCAGGTGCTGTGCTGGG + Intronic
902513345 1:16977721-16977743 CACGTGCCAAGTGCTGGGCTAGG - Intronic
902559516 1:17268147-17268169 CTCAGGCCAGGTGTTGTGCTGGG - Intronic
902636057 1:17735816-17735838 CACATGCCAGCTGCTCCTGTGGG + Intergenic
902678801 1:18028755-18028777 GAGCTGTCAGGTGCTGTTCTGGG - Intergenic
902757579 1:18559134-18559156 TACATACCTGGTACTGTTCTGGG + Intergenic
902760552 1:18578009-18578031 TATATGCCAGGTGTTTTTCTGGG + Intergenic
902763940 1:18602212-18602234 CACATGCCAGGCACTGTTCTTGG - Intergenic
902852511 1:19171375-19171397 TACGTGCCAGGTACTTTTCTAGG - Intronic
902896341 1:19483029-19483051 CCAACGCCAGGTGCTGTTCTAGG + Intronic
903168088 1:21535055-21535077 AATATGCCAGGGGCTGTTCTAGG - Intronic
903224038 1:21885000-21885022 CTCATCCCAGGTGCGGCTCTGGG - Exonic
903273288 1:22205418-22205440 CACGTGCCAGGAGCTGTGCCAGG - Intergenic
903303774 1:22398031-22398053 TACATGTCAGGTGTTGTTTTAGG + Intergenic
903381120 1:22897455-22897477 CATATGCCAGGCACTGTTCTAGG + Intronic
903409220 1:23126597-23126619 CATATGCCAGGTACTGTTCTGGG - Intronic
903536824 1:24072286-24072308 CACATGGTAGGTGCTCCTCTAGG - Intronic
903746829 1:25592731-25592753 TAGGTGCCAGGCGCTGTTCTAGG - Intergenic
903819085 1:26087422-26087444 TACATGCCAGGCACAGTTCTAGG + Intergenic
903832097 1:26181648-26181670 CACATGCCAAGCCCTGTTCTAGG - Intronic
903882215 1:26518777-26518799 TACATGCCAGGCACTGTTCTAGG - Intergenic
903946564 1:26967720-26967742 CACTTACCATGTGCTGGTCTCGG - Intergenic
903989543 1:27256744-27256766 TACATGCCAGGTGCTGTTCCTGG - Intronic
904200936 1:28818676-28818698 CACCTGCTAGGTGCTGAGCTTGG + Intronic
904596345 1:31648425-31648447 CTCTTGCCAGGCTCTGTTCTAGG + Intergenic
904871438 1:33621487-33621509 AACATGCCAGGCACTGTGCTGGG - Intronic
904990629 1:34589920-34589942 TATATGCCAGGTGTTGTGCTGGG + Intergenic
905160506 1:36029147-36029169 TATATGACAGGTGCTATTCTAGG - Intronic
905262473 1:36729565-36729587 CCCCTGCCAGGCGCTGTGCTAGG + Intergenic
905275993 1:36818655-36818677 TACATGCCAGGCTCTGTGCTGGG - Intronic
905533775 1:38702488-38702510 AACCTGCCAGGAGCTCTTCTAGG + Intergenic
905771576 1:40641563-40641585 CATACACCAGGTGCTGTTCTAGG - Intronic
905804064 1:40863170-40863192 CACATACCAGGCACTGTGCTAGG - Intergenic
906082288 1:43101287-43101309 GACATGCCAGCTGCTGCTGTGGG + Intergenic
906188068 1:43876862-43876884 AATATGCTAGGTGCTGTTCTAGG + Intronic
906276668 1:44521819-44521841 TACATGCTAGGTACTGTACTAGG - Intronic
906568353 1:46816125-46816147 CACATGCCAGGTGCTATCAGGGG + Intronic
906650004 1:47506255-47506277 TATATGCCAGGTTCTGTTTTAGG + Intergenic
906668015 1:47635323-47635345 CACATCTCAGGTGCTGTCCTGGG + Intergenic
906929796 1:50158152-50158174 TATATGCCAGGTGTTGTTCTGGG - Intronic
907268330 1:53276119-53276141 CCTGTGCCAGGTGCTGTGCTGGG + Intronic
907423027 1:54360023-54360045 TATATGTCAGGTACTGTTCTAGG - Intronic
907550663 1:55302145-55302167 CACAAGCCAGGAGCTGCTCATGG - Intergenic
907626772 1:56038124-56038146 CACATGGCTGTTGCTTTTCTAGG + Intergenic
907637349 1:56149265-56149287 TACATGCCAGGTGCTGTGATGGG + Intergenic
907709063 1:56861156-56861178 TATATGCCAGGTACTGTTCTGGG + Intronic
907907947 1:58801304-58801326 CACACTCCAGGGGCTGTTGTGGG - Intergenic
908014826 1:59820258-59820280 CACATGCCAGGCCCTGATATAGG + Intronic
908365360 1:63417683-63417705 CATATGCCAGGTCCTCCTCTAGG + Intronic
908493399 1:64669109-64669131 CAGATACCAGGCACTGTTCTAGG - Intronic
909515627 1:76503994-76504016 AACATGCCAGGTTCTGGGCTTGG - Intronic
909690667 1:78403965-78403987 CACATGCCAGGCACTGTGTTAGG + Intronic
910158907 1:84252813-84252835 CACATGCCAGGCACTATGCTAGG + Intergenic
910260469 1:85289061-85289083 CATATGTCAGGGTCTGTTCTAGG - Intergenic
910278132 1:85469765-85469787 CATATGCCAGGTATTGTGCTAGG + Intronic
910623349 1:89280065-89280087 CACACTCCAGGTTCTGTTATTGG + Intergenic
910689352 1:89949869-89949891 AACAGGCCAGGTTCTATTCTAGG - Intergenic
910693403 1:89987615-89987637 CACATGCCAGGTATGGTGCTAGG + Intergenic
911152365 1:94607957-94607979 TACATGCCAGGAGTTGTGCTAGG - Intergenic
911645492 1:100333417-100333439 TATGTGCCAGGTACTGTTCTAGG + Intergenic
911676364 1:100663140-100663162 CACACACCAGGTCCTGTTGTGGG - Intergenic
911723775 1:101220091-101220113 CAGATGCCAGGAGCTGCTCCAGG - Intergenic
911873738 1:103132587-103132609 CACACACCAGGTCCTGTTGTGGG - Intergenic
912367837 1:109149619-109149641 ACTATGTCAGGTGCTGTTCTGGG + Intronic
912847060 1:113083834-113083856 CACATGCCAGGGCCTGTTGTGGG + Intronic
913044304 1:115060860-115060882 TAGGTGCCAGGTGGTGTTCTAGG - Intronic
913229926 1:116733232-116733254 CACTTGCCAGCTGCTGTTCTAGG - Intergenic
913988732 1:143588869-143588891 CACATGGCAGGTTCTGTCTTTGG - Intergenic
914235530 1:145807049-145807071 TATATTCCAGGAGCTGTTCTAGG - Intronic
914441721 1:147713380-147713402 CACACACCAGGTCCTGTTGTGGG - Intergenic
914448335 1:147769499-147769521 TATATGCCAGATACTGTTCTAGG - Intronic
915003916 1:152619266-152619288 CCCATGCCAGGTGCCACTCTAGG + Intergenic
915160665 1:153917715-153917737 TACATGCCAGGCACTGTACTAGG + Intronic
915181317 1:154063030-154063052 TACATGCCAGGTGCTATGTTAGG + Intronic
915245599 1:154554061-154554083 TACATGCCAGGTTCTGTCCTAGG + Intronic
915330419 1:155108421-155108443 CATCTGCCAGGTGCTGTACCGGG + Intergenic
915599058 1:156910879-156910901 TACATGCTGGGTACTGTTCTAGG + Intronic
915919659 1:159965117-159965139 TAAATGCCAGGCACTGTTCTAGG + Intergenic
916087141 1:161279357-161279379 CACATGGCAAGTATTGTTCTAGG - Intronic
916204489 1:162301951-162301973 CTCATGCCAGGTACTGTGCTAGG + Intronic
916422305 1:164648449-164648471 CACATGCCAGCTACCGTTGTAGG + Intronic
916459234 1:165005606-165005628 AACATGCCAGGCACTGTTCTAGG - Intergenic
916582916 1:166124403-166124425 TATATGCCAGGCACTGTTCTAGG + Intronic
916615333 1:166433593-166433615 CACATACCAGGGACTGTTGTGGG - Intergenic
916620272 1:166489378-166489400 CATGTGCCAGGCCCTGTTCTAGG + Intergenic
916625522 1:166551823-166551845 CATCTGGCAGGTGCTGCTCTGGG - Intergenic
916909865 1:169335533-169335555 CACATACCAGGGCCTGTTGTGGG + Intronic
917296377 1:173523457-173523479 TACATGCCAGAGACTGTTCTAGG - Intronic
917436897 1:175031260-175031282 TACATGTCAGATACTGTTCTAGG + Intergenic
917700584 1:177576567-177576589 CGTGTGCCAGCTGCTGTTCTAGG - Intergenic
917751698 1:178059153-178059175 CACATGCTAGGTAGTGTTCTGGG + Intergenic
917828646 1:178852356-178852378 CACGTGCCAGGCACTGTTGTAGG - Intronic
917860415 1:179138460-179138482 CACATGCAAGGCACTGTGCTGGG + Intronic
918034768 1:180857439-180857461 CACATGCCAGATATTATTCTAGG - Intronic
918079244 1:181193022-181193044 AACGTGCCAGGTACTGTTCCAGG + Intergenic
918235126 1:182572840-182572862 TACATGCCAGGCACTGTACTAGG + Intergenic
918277209 1:182964857-182964879 TATATGCCAGGTTCTGTTCTGGG + Intergenic
918480983 1:184976165-184976187 TACATGCTAGGTGCTCTTCTAGG - Intergenic
918524208 1:185447286-185447308 CACATGCAAAGGGCTGTCCTGGG + Intergenic
919121612 1:193347955-193347977 TATATGCCAGGCACTGTTCTAGG - Intergenic
919322650 1:196062576-196062598 CACACACCAGGTCCTGTTGTGGG + Intergenic
919609963 1:199733042-199733064 CACATACCAGGGCCTGTTGTGGG + Intergenic
919655245 1:200191339-200191361 CACATACCAGGGACTGTTGTGGG + Intergenic
920368899 1:205464832-205464854 TACATGCCAGGCACTGTACTAGG + Intergenic
920388279 1:205582911-205582933 CCCCTGCCTGGTGGTGTTCTGGG - Intronic
920854908 1:209654301-209654323 GACATGCCAATTGCTGTGCTTGG + Intergenic
921353704 1:214264168-214264190 TATATGCCAGGTGCTGTTTTAGG - Intergenic
921371480 1:214427557-214427579 TACATGCCAGGAGTTATTCTAGG + Intronic
921607889 1:217176650-217176672 TACATGCAAGGTGCCATTCTTGG - Intergenic
921758624 1:218886669-218886691 CACAGGCCAAGAGCTGTTCTCGG - Intergenic
921942659 1:220858939-220858961 CACATACCAGGTCCTGTCGTGGG - Intergenic
922109263 1:222541669-222541691 CATGTTCCAGGTGCTGTGCTAGG - Intronic
922469034 1:225864241-225864263 CACCTGCCAGGCACTGTTCTAGG + Intronic
922605541 1:226887771-226887793 TACTTGCCAGGCACTGTTCTAGG - Intronic
923002517 1:230019367-230019389 TATATGCCAGGTGCTGAACTAGG + Intergenic
923705441 1:236340772-236340794 AAAATGCCGGGTGCTGTTCTAGG + Intergenic
923996441 1:239500447-239500469 CACATACCAGGGCCTGTTATGGG + Intronic
923999499 1:239534970-239534992 TACATGCCAGGCACTGTGCTAGG + Intronic
924265029 1:242273086-242273108 CACATGCCAGGGCCTGTTGGGGG - Intronic
924293923 1:242566574-242566596 CACATGCCAGTGGGAGTTCTGGG - Intergenic
924302685 1:242655620-242655642 CACCAGGCAGGTACTGTTCTAGG + Intergenic
924302913 1:242657966-242657988 CAAATGCCAGGTGCAATTCCAGG - Intergenic
924408055 1:243773018-243773040 CACACACCAGGGGCTGTTGTGGG + Intronic
1063068602 10:2636192-2636214 TATATGCCAGGTCCTATTCTTGG - Intergenic
1063945961 10:11176609-11176631 CATATGCCAGGCGCTGTCCTAGG - Intronic
1064001942 10:11670872-11670894 CACATGCCAGGCACTGTTCTAGG + Intergenic
1064033789 10:11899654-11899676 CACATGCCCTGTGCTCATCTGGG + Intergenic
1064164245 10:12973096-12973118 TACGTGCCAGGTGCTCTGCTGGG + Intronic
1065669808 10:28103707-28103729 TACATTCTAGATGCTGTTCTGGG - Intronic
1066205829 10:33188446-33188468 TACATGGCAGGTGCTGTGTTGGG - Intronic
1066413153 10:35193178-35193200 CACATGCCAGGGTCTGTGCTAGG - Intronic
1066596570 10:37057472-37057494 CACGTGCCAGGTGCTGAGCTAGG - Intergenic
1066703051 10:38149982-38150004 CACTTACCAGGTACTTTTCTAGG - Intergenic
1066987811 10:42483707-42483729 CACTTGCCAGGTACTTTTCTAGG + Intergenic
1067065672 10:43102777-43102799 CAGGGGCCAGGTACTGTTCTAGG + Intronic
1067088266 10:43254070-43254092 CACATGCCAGGCCCAGTGCTCGG + Intronic
1067193113 10:44089236-44089258 TACATGCCAGGTTCTGGGCTAGG + Intergenic
1067204279 10:44200105-44200127 AACATGCCAGGTCTTGTCCTTGG + Intergenic
1067511040 10:46895362-46895384 CTCATGCCAGAGGCTGCTCTGGG - Intergenic
1067651213 10:48156500-48156522 CTCATGCCAGAGGCTGCTCTGGG + Intergenic
1067775466 10:49161850-49161872 CACGTGCAGGGAGCTGTTCTTGG - Intronic
1067925634 10:50505622-50505644 AATATGCCAGGCACTGTTCTAGG + Intronic
1068369022 10:56090081-56090103 CACATACCAGGGCCTGTCCTGGG + Intergenic
1068508414 10:57932788-57932810 CACATACCAGCTGCTGTTTGGGG + Intergenic
1068712016 10:60145850-60145872 TATGTGCCAGGTTCTGTTCTGGG - Intronic
1069167889 10:65186674-65186696 CACATACCAGGGGCTGTCATGGG - Intergenic
1069307096 10:66984116-66984138 CACATGCCAGGTACTATTCTAGG + Intronic
1069487399 10:68832731-68832753 CATGAGCCAGGTACTGTTCTAGG + Intronic
1069616847 10:69811632-69811654 CATAAGTCAGGTGCTGCTCTAGG + Intronic
1069717067 10:70527940-70527962 CACATACCAGGGCCTGTTGTGGG - Intronic
1069905551 10:71730284-71730306 CACGCGCCAGGTGCTGTGCAAGG + Intronic
1070212287 10:74337370-74337392 CACCTGCCTGGTGCTGTGGTGGG + Intronic
1070408982 10:76121909-76121931 TATGTGCCAGGTACTGTTCTAGG + Intronic
1070454937 10:76603643-76603665 CACATACCAGGGCCTGTTGTGGG + Intergenic
1070528285 10:77313704-77313726 CATGTGCCAGGTACTGTGCTAGG - Intronic
1070696748 10:78569544-78569566 CACATGCCAGGAGCTGCTTCTGG - Intergenic
1070728657 10:78809597-78809619 CACATGCCAGGTATGATTCTGGG - Intergenic
1071068629 10:81666783-81666805 GAGAAGCCAGGTGCTGTCCTTGG + Intergenic
1071088912 10:81896834-81896856 TACTTGCCAGATGCTGTTTTAGG + Intronic
1071252730 10:83837606-83837628 TATATGCCAGGTACTATTCTAGG - Intergenic
1071293062 10:84201245-84201267 CTTGTGCCAGGTGCTGTTATTGG - Intronic
1071998001 10:91164976-91164998 TATATGCCAGGCACTGTTCTAGG - Intronic
1072196194 10:93118988-93119010 CACATGCCAGGTACAGATGTGGG - Intergenic
1072229626 10:93403324-93403346 AATGTGCCAGGTGCTGTACTAGG + Intronic
1072430268 10:95365043-95365065 TACGTGCCAGGTCCTGTGCTTGG - Intronic
1072756304 10:98023434-98023456 CACATGCCAAGTGCCATGCTAGG + Intronic
1073043760 10:100624146-100624168 AGCATGCCAGGTGCTGTGCTAGG + Intergenic
1073201419 10:101738871-101738893 TACATGCCAGGTACTCTACTGGG - Intergenic
1073480318 10:103782575-103782597 TATATGGCAGGTACTGTTCTAGG + Intronic
1073589970 10:104747728-104747750 TACATGCCAGGAACTGTGCTAGG - Intronic
1073689398 10:105790886-105790908 CACAGGGGAGGTGCTGGTCTTGG - Intergenic
1073943377 10:108723592-108723614 CACACACCAGGTACTGTTGTGGG - Intergenic
1074045776 10:109837852-109837874 CACATGCCAAGTATTGTGCTAGG + Intergenic
1074080969 10:110167914-110167936 CACAGGCCAAGTGCTGTTCTAGG - Intergenic
1074232976 10:111556014-111556036 CATGTGTCAGGTGCTTTTCTGGG + Intergenic
1074242418 10:111652218-111652240 CACGTGCCAGATGCTGTTCAAGG + Intergenic
1074291045 10:112138218-112138240 CACATGCCACCTGCTGTCTTGGG - Intergenic
1074437820 10:113449335-113449357 CAAGTGCCAGATGCTGTACTAGG + Intergenic
1074773594 10:116749569-116749591 CATGTGCCAGGTGCTGCGCTAGG - Intergenic
1074775085 10:116762072-116762094 CACATGCTAGGCACTGTGCTAGG + Intergenic
1074786428 10:116846082-116846104 CACGTGCCAGATGCTGTTCTAGG - Intergenic
1074891103 10:117737255-117737277 CATGTGCCAGGAACTGTTCTAGG + Intergenic
1074947666 10:118296920-118296942 TACATGCCAGGCACTGTACTAGG - Intergenic
1075067226 10:119297270-119297292 TAAATGCCAGATCCTGTTCTAGG - Intronic
1075557958 10:123447069-123447091 AACGTCCCAGGTGCTGTTCAAGG + Intergenic
1075636447 10:124034147-124034169 CACAGGCTGGGTGCTGTGCTGGG - Intronic
1075679069 10:124319551-124319573 CACATACCAGGGCCTGTTGTGGG - Intergenic
1075895923 10:125994345-125994367 TACATGCCAAGTCCTGTGCTAGG - Intronic
1075975166 10:126688116-126688138 CAGATGCCAGGCACAGTTCTAGG + Intergenic
1075980940 10:126738641-126738663 ACCATGCCAGGTGTGGTTCTTGG - Intergenic
1076091062 10:127686073-127686095 CATATGCCAAGCACTGTTCTTGG + Intergenic
1076171531 10:128324012-128324034 CACATGCCTAGTGCTGAGCTGGG - Intergenic
1076386276 10:130058226-130058248 CACAATCCATGTGCAGTTCTAGG + Intergenic
1076467799 10:130697049-130697071 CTCTTTCCGGGTGCTGTTCTGGG + Intergenic
1076537855 10:131194210-131194232 CATGTGCCAGGCACTGTTCTTGG + Intronic
1076742523 10:132493842-132493864 CAGGCGCCAGGTGCTGTGCTGGG - Intergenic
1077118183 11:894807-894829 CACATGCCAGGCCCTGGTCCTGG - Intronic
1078081615 11:8208339-8208361 TACGTGCCAGACGCTGTTCTAGG + Intergenic
1078435227 11:11319434-11319456 CATGTGCCAGATACTGTTCTTGG - Intronic
1078491293 11:11771516-11771538 TATGTGCCAGGTGCTGTTCTAGG + Intergenic
1078531883 11:12142955-12142977 CAAATGCCAGGTCCTGGGCTTGG + Intronic
1078652784 11:13211308-13211330 CAAGTGCCAGGTACTGTTTTTGG + Intergenic
1078884606 11:15487889-15487911 CATATGCCAGAGGCTGTTCTAGG - Intergenic
1079154241 11:17929628-17929650 TATATGCCAGGCGCTGTGCTAGG + Intronic
1079323123 11:19469049-19469071 CACATGCCAGGTACTATGCTAGG - Intronic
1079374717 11:19881631-19881653 CACATGCCAGACACTGTTCTAGG + Intronic
1079377995 11:19911154-19911176 CATGTGCCAGATGCTGTGCTTGG + Intronic
1079395891 11:20063139-20063161 TACGTGCTAGGTACTGTTCTAGG - Intronic
1079744679 11:24109625-24109647 CACATGTCAGGCACTGCTCTGGG - Intergenic
1080318652 11:30980168-30980190 TATATGCCAGATGCTGTGCTAGG - Intronic
1080464871 11:32487299-32487321 CACATGTCAGGCCCTGCTCTAGG + Intergenic
1080539563 11:33253495-33253517 TACATGCAAGGCCCTGTTCTAGG + Intergenic
1080563702 11:33488514-33488536 CACATATCAGATGCTGTTTTAGG + Intergenic
1080662827 11:34311283-34311305 CACTTGCAATGTGCTTTTCTGGG - Intronic
1080688441 11:34535286-34535308 TACGTGCCAGGCACTGTTCTGGG - Intergenic
1081187041 11:40056291-40056313 CAAATGCCAGTAGCTTTTCTTGG - Intergenic
1081505946 11:43717257-43717279 TATATGTCAGGTACTGTTCTAGG - Intronic
1081527422 11:43936421-43936443 AACATGCCGGGTACTGTGCTAGG + Intronic
1081748984 11:45494332-45494354 CAGATGTCAGCTTCTGTTCTTGG - Intergenic
1081801138 11:45860064-45860086 CACATTCCCGGGGCTCTTCTTGG - Intronic
1081885344 11:46490813-46490835 CATATGCCAGGCAGTGTTCTAGG - Intronic
1082629582 11:55526166-55526188 CACATGCCAGGGACTGTTGTGGG - Intergenic
1082809656 11:57471742-57471764 CACATGCCAGGCAATGTTCCAGG + Intronic
1082821249 11:57546043-57546065 CACAGGCCAGGGGCTGGGCTGGG + Intronic
1082896127 11:58191713-58191735 CACATGCTAGGTGCTTTGCTAGG - Intergenic
1083340692 11:61956691-61956713 CACCTACTAGGTGCTGTTCTGGG - Intronic
1084120725 11:67067428-67067450 CACGTGCCAGGCAGTGTTCTTGG + Intronic
1084268210 11:68015662-68015684 TATGTGCCAGGTACTGTTCTAGG + Intronic
1084409476 11:68998067-68998089 TACATGCCAGGCAATGTTCTAGG - Intergenic
1084482194 11:69428488-69428510 CACCTGCCTGGTGATGCTCTTGG + Intergenic
1084573104 11:69971383-69971405 CACGTGCCAGGCACAGTTCTAGG - Intergenic
1084668931 11:70593871-70593893 TACAGTCCAGATGCTGTTCTAGG + Intronic
1084676474 11:70638323-70638345 CACAGACCAGCTGCTGTGCTGGG + Intronic
1085184808 11:74566539-74566561 TACATGCCAGCTGCTGCTCTGGG + Intronic
1085565163 11:77507001-77507023 CTTATGCCAGGTATTGTTCTTGG - Intergenic
1085603023 11:77872415-77872437 CTCATGCCAGGTCCTGTGCTAGG + Intronic
1085853626 11:80150749-80150771 CATACACCAGGTACTGTTCTGGG - Intergenic
1085862478 11:80250599-80250621 AATATGCCAGGAGCTGTTCAAGG - Intergenic
1085893039 11:80603643-80603665 CATGTGCCAGGTGCTGAGCTAGG + Intergenic
1086044077 11:82512029-82512051 CACATGCCAGGAAGTTTTCTAGG - Intergenic
1086070010 11:82789851-82789873 CACAGGCCAGGTGCTCTTCATGG - Intergenic
1086156864 11:83676896-83676918 CACGTGCCAAGTGCTCTGCTGGG - Intronic
1086353668 11:85970085-85970107 TACATGTCAGGCACTGTTCTAGG + Intronic
1087006028 11:93472707-93472729 TATGTGCCAGGTACTGTTCTTGG - Intergenic
1087043195 11:93821429-93821451 TATATGCCAGGAACTGTTCTAGG + Intronic
1087092445 11:94287535-94287557 GATATGTCAGGTGCTATTCTGGG + Intergenic
1087192487 11:95269530-95269552 TACATGCCAGGTACTATTCTAGG - Intergenic
1088294600 11:108277978-108278000 CACATGCCAAGTATTGTTTTAGG - Intronic
1088329747 11:108639113-108639135 TGTGTGCCAGGTGCTGTTCTAGG + Intergenic
1088531098 11:110810506-110810528 TATATGCCAGGTACTGTTCTAGG - Intergenic
1089027566 11:115287821-115287843 TACATGCCAGGGACTCTTCTAGG + Intronic
1089647378 11:119889157-119889179 CTTATGCCAGATACTGTTCTAGG - Intergenic
1089654324 11:119935835-119935857 TAAGTGCCAGGTGCTGTGCTGGG + Intergenic
1089674504 11:120080853-120080875 TACATGCCAGGTACCATTCTAGG - Intergenic
1089678953 11:120108899-120108921 CACGTGCCAGGCACTGTTCTAGG + Intergenic
1089794761 11:120971313-120971335 CTGATGGCAGGTGATGTTCTGGG - Intronic
1089811646 11:121136910-121136932 GACATGCCAGGCACTGTCCTAGG - Intronic
1089886713 11:121831923-121831945 TACATGCCAGGCTCTGTGCTTGG - Intergenic
1090055946 11:123425302-123425324 CACATGCCACCTGCTTTCCTTGG + Intergenic
1091003616 11:131932108-131932130 CATGTGCCAGGCACTGTTCTAGG + Intronic
1091113730 11:132994702-132994724 CAAATGCCAGGCTCTGTTCTTGG + Intronic
1091119692 11:133046624-133046646 CACATGCCAGGGGCTATGCAGGG - Intronic
1091287580 11:134416367-134416389 CATATGCCAGGCACTGTGCTGGG + Intergenic
1091313067 11:134588411-134588433 CACATCGCAGGTGCAGCTCTCGG - Intergenic
1091313096 11:134588626-134588648 CACATCGCAGGTGCAGCTCTCGG - Intergenic
1091412957 12:256248-256270 CAAAAGCCAGGAACTGTTCTAGG - Intronic
1091619908 12:2079110-2079132 CACACACCAGGGGCTGTTGTGGG + Intronic
1091750106 12:3017057-3017079 CACAAGACAGGTGCTGAGCTAGG + Intronic
1091873897 12:3917884-3917906 CATATGCTAGATGCTGTGCTTGG - Intergenic
1091995908 12:4993938-4993960 TACATGCCAAGTGCTCTGCTGGG + Intergenic
1092064237 12:5576621-5576643 GACATGCCAGATGCTGTGTTGGG - Intronic
1092270505 12:7019378-7019400 CATATGCCAGGGACTGTGCTGGG + Intronic
1092390885 12:8077717-8077739 CATGTGCCAGGCACTGTTCTAGG + Intergenic
1092394078 12:8109744-8109766 CATATTCCAGGCCCTGTTCTAGG - Intergenic
1092808911 12:12253584-12253606 CACACACCAGGTCCTGTTGTGGG - Intronic
1092830992 12:12444086-12444108 TACATGCCAGGCATTGTTCTAGG - Intronic
1092915784 12:13187897-13187919 CATGTGCCAGGCACTGTTCTAGG + Intergenic
1092926267 12:13275262-13275284 CATATACCAGGCACTGTTCTAGG - Intergenic
1093223762 12:16455457-16455479 TACCTGCCAAGTGCTGTGCTAGG - Intronic
1093987634 12:25554724-25554746 CACATGACACGTGCCTTTCTAGG + Intronic
1094398197 12:30031479-30031501 TAAATGCCAGGTTCTATTCTAGG + Intergenic
1094426017 12:30317921-30317943 CATGTGTCAGGTGCTGTGCTGGG - Intergenic
1094643064 12:32295418-32295440 TATGTGCCAGGTGCTGTGCTAGG + Intronic
1094798099 12:34000175-34000197 CACATGCCAGGTTTAGTTCCTGG + Intergenic
1095452218 12:42344138-42344160 TGTGTGCCAGGTGCTGTTCTAGG + Intronic
1095743810 12:45635293-45635315 CATATACCAGGCACTGTTCTAGG + Intergenic
1096249782 12:50023091-50023113 CAAATGTCAGGTACTGTTCTAGG - Intronic
1096409795 12:51368935-51368957 CAGGTGCCAGATGCTGTTCTGGG + Intronic
1096412483 12:51387485-51387507 CACATGCCAAGCGCTGCTCTAGG - Intronic
1096589820 12:52650541-52650563 GTCATGGCAGGTGCGGTTCTTGG - Exonic
1097370052 12:58767301-58767323 TATGTGCCAAGTGCTGTTCTAGG + Intronic
1097435482 12:59548764-59548786 CACATGGCAGGTGCCCCTCTGGG - Intergenic
1097570197 12:61322696-61322718 CACACACCAGGGGCTGTTTTGGG + Intergenic
1097678780 12:62630184-62630206 TACATGCTGGGTGCTGTACTGGG - Intergenic
1097857701 12:64483476-64483498 CACATAACAAGTGCTGTTCTTGG + Intronic
1097922529 12:65091866-65091888 CATGTGCCAGGTTCTGCTCTAGG + Intronic
1098224611 12:68308711-68308733 CAAGTGCCAGGCACTGTTCTAGG - Intronic
1098444946 12:70556893-70556915 TATGTGCCAGGTGCTCTTCTGGG + Intronic
1098721431 12:73903732-73903754 CACATGCCGGGGCCTGTTGTGGG - Intergenic
1098784337 12:74731222-74731244 TATATGCCAGGTGCTGTTCTAGG + Intergenic
1098854365 12:75635648-75635670 CACGTTCCAGGTATTGTTCTAGG + Intergenic
1098991521 12:77068985-77069007 CACATGCCAGGGCCTGTCATGGG - Intergenic
1099140869 12:78973801-78973823 TATATGCCAAGTGATGTTCTAGG + Intronic
1099208810 12:79759664-79759686 CACATACCAGGGCCTGTTGTGGG - Intergenic
1099385987 12:82014106-82014128 CACACACCAGGTCCTGTTGTGGG - Intergenic
1099434695 12:82629286-82629308 CACACGCCAGGGACTGTTGTGGG - Intergenic
1099708724 12:86192074-86192096 CACATACCAGGGCCTGTTGTGGG + Intronic
1099783439 12:87230141-87230163 TAGATGCCAGGTACTGTACTAGG - Intergenic
1099834343 12:87888507-87888529 CACATACCAGGGGCTGTTGTGGG - Intergenic
1100819273 12:98416187-98416209 CACTTGCCAGGCACTGTACTAGG - Intergenic
1100890713 12:99122942-99122964 CATGTGCCAGGTTCTGTTCTAGG + Intronic
1101048519 12:100836501-100836523 CACATACCAGGGCCTGTTGTGGG - Intronic
1101092590 12:101303199-101303221 CACATGCCAAGCCCTGTTCCAGG + Intronic
1101422250 12:104559266-104559288 TACATGCCAAGTACTGTGCTAGG - Intronic
1101563242 12:105880258-105880280 ATTATGTCAGGTGCTGTTCTAGG - Intergenic
1101861340 12:108484877-108484899 TATATGCCAGGTACTGTTCTAGG - Intergenic
1102040240 12:109796345-109796367 CACATGGCAGACACTGTTCTGGG + Intronic
1102041698 12:109805204-109805226 CACATACCAGGCACTGTGCTTGG - Intronic
1102307339 12:111815157-111815179 TACATGCCAGGAACTGTACTTGG + Intergenic
1102368538 12:112361227-112361249 CATATGTCAGTTGCTATTCTGGG + Intronic
1102464373 12:113119943-113119965 CACCTGCCAGGTGCTATGCTTGG - Intronic
1102510980 12:113415189-113415211 CTTATGCCAGGCACTGTTCTAGG - Intronic
1102764196 12:115417390-115417412 CAACTGCCAGGTGCTGTGATAGG - Intergenic
1103033130 12:117634072-117634094 CACATGCTAGGGGCTGGGCTAGG - Intronic
1103397637 12:120620222-120620244 CATGTGCCAGGTACTGGTCTAGG - Intergenic
1103930162 12:124445772-124445794 TACACGCCAGGCACTGTTCTGGG - Intronic
1103971392 12:124674950-124674972 TGCATGCCAGGAGCTGGTCTGGG + Intergenic
1103987408 12:124777267-124777289 GACATGCCCCGTGTTGTTCTAGG - Intronic
1104020389 12:124988493-124988515 TACATGCCAGGCACTATTCTAGG - Intronic
1104423164 12:128653725-128653747 CAAGTACCAGGTGCTGTTCCAGG - Intronic
1104479738 12:129097060-129097082 CACGTGCCAGGTGCTGGTCCTGG + Intronic
1104761156 12:131298421-131298443 TACGGGCCAGGTGCTGTCCTGGG + Intergenic
1104775486 12:131388018-131388040 CACATGCCTGGAGCAGTTCTGGG + Intergenic
1104818619 12:131662371-131662393 TACGGGCCAGGTGCTGTCCTGGG - Intergenic
1105427197 13:20304102-20304124 CACATGCCAGGTACTGTGCTAGG + Intergenic
1105448209 13:20475408-20475430 CTCATGCCAGGCACTGTTTTAGG + Intronic
1106159112 13:27184827-27184849 TACGTGCCAGGCACTGTTCTAGG + Intergenic
1106179532 13:27358848-27358870 CACAAGGTAGGTGCTGTTATTGG - Intergenic
1106310852 13:28552988-28553010 CACATGCCAGGCACTATTCTAGG + Intergenic
1106363842 13:29058723-29058745 CACATACCAGGGCCTGTTGTGGG - Intronic
1106681557 13:32013621-32013643 CACATGCTAGGCATTGTTCTGGG + Intergenic
1106806748 13:33316459-33316481 CACATGCCAGAAGCTGTCCCAGG + Intronic
1107256428 13:38433046-38433068 CACACACCAGGTCCTGTTGTGGG - Intergenic
1107536209 13:41336213-41336235 TACATGCCAGGTACTGTTCTAGG - Intronic
1107555539 13:41514214-41514236 CTCAGGCCAGGTATTGTTCTGGG + Intergenic
1107714823 13:43189689-43189711 CACATGCCAAGCTCTGTTCTAGG - Intergenic
1107966620 13:45603557-45603579 AACATGCCAGGTGCTGGTCAGGG + Intronic
1107979877 13:45724541-45724563 TATATGCCAGGTACTGTGCTGGG - Intergenic
1108190204 13:47930578-47930600 CACATGCTAGGCACTGTTCTAGG - Intergenic
1108224154 13:48270398-48270420 TACGTGCCAGGTGCTTTACTAGG - Intergenic
1108489441 13:50966100-50966122 CACATACCAGGTGCCATTTTGGG + Intronic
1108554173 13:51576952-51576974 AACATGCCAGGTGCTACTTTAGG + Intergenic
1108598000 13:51966167-51966189 AACATGGCTGGTGCTGTCCTAGG + Intronic
1108715738 13:53076187-53076209 CATGTGCCAGGAACTGTTCTAGG - Intergenic
1109006470 13:56883820-56883842 TACATGCCATGTGCTATTTTAGG - Intergenic
1109757578 13:66780813-66780835 CACGTGCTAGATACTGTTCTAGG - Intronic
1109964456 13:69673348-69673370 CAAATACCAGGCACTGTTCTAGG - Intergenic
1109997791 13:70152608-70152630 TACATGCCAGGTGCTACACTAGG - Intergenic
1110485828 13:76040747-76040769 CACATTCCTGGTCCTGTTCAGGG - Intergenic
1111512202 13:89280907-89280929 AACATGTCAGGTGCTCCTCTAGG - Intergenic
1112369437 13:98782046-98782068 CACATGGCAGTTGCTCTTCCTGG - Intergenic
1112602160 13:100867893-100867915 CACATCCCAGGTGCTATAATAGG - Intergenic
1112614292 13:100987529-100987551 CACATACCAGGGCCTGTTGTGGG - Intergenic
1112703759 13:102042531-102042553 TATATGCCAGGCCCTGTTCTAGG - Intronic
1112953527 13:105031975-105031997 CACATGGCAGATGGAGTTCTTGG - Intergenic
1113328039 13:109301819-109301841 CAGATGCCAGGAGCTCTCCTGGG - Intergenic
1113490671 13:110689269-110689291 CAGGTGGCAGGTGCTGTGCTTGG - Intronic
1113521893 13:110947320-110947342 CACGTGCCAGGCACTGTCCTAGG - Intergenic
1113706000 13:112433379-112433401 CACGTGCCAGGCACTGTCCTAGG + Intronic
1113928267 13:113952925-113952947 CACGTGGCAGGAGCTGCTCTCGG + Intergenic
1114034161 14:18606153-18606175 CACATGCCAGAGCCTGTTGTGGG - Intergenic
1114078959 14:19185331-19185353 CACACGCCAGGGCCTGTTGTGGG - Intergenic
1114124482 14:19708856-19708878 CACACGCCAGGGCCTGTTGTGGG + Intergenic
1114454327 14:22845481-22845503 CACATACCAGGCGCTGGGCTAGG + Intronic
1114669801 14:24403638-24403660 TACATGCCAGGCACTGTTTTAGG - Intronic
1115345537 14:32339174-32339196 CATATGCCAGGCACTATTCTGGG - Intronic
1115420730 14:33192050-33192072 CACCTGCCAGGTGTTGTCCATGG + Intronic
1115819299 14:37197119-37197141 CATGTGCCAGGTACTCTTCTGGG - Intergenic
1115993547 14:39173400-39173422 TATGTGCCAGGTGCTATTCTAGG - Intergenic
1116515020 14:45794770-45794792 CACATACCAGGGCCTGTTGTGGG - Intergenic
1117243880 14:53863980-53864002 TGCGTGCCAGGTTCTGTTCTGGG + Intergenic
1117327657 14:54684199-54684221 CACAAGCAAGGAGCTTTTCTAGG - Intronic
1117538410 14:56723595-56723617 CATGTGCCAGGCACTGTTCTAGG + Intronic
1117808440 14:59519149-59519171 CACATACCAGGGCCTGTTGTCGG + Intronic
1118039211 14:61899398-61899420 CATGTGCCAGGTGCTTTGCTAGG + Intergenic
1118477239 14:66128965-66128987 TAAATGCCAGGCACTGTTCTAGG + Intergenic
1118497777 14:66325776-66325798 TACGTGCCAGGCACTGTTCTAGG - Intergenic
1118650255 14:67883820-67883842 TATATGCCAGGCACTGTTCTGGG - Intronic
1118744251 14:68762553-68762575 CATGTGCCAGGTCCTGTGCTAGG - Intergenic
1119492891 14:75051820-75051842 CATAGGCCAGGCACTGTTCTTGG - Intergenic
1119497611 14:75093909-75093931 CATTTGCCAGGCACTGTTCTAGG + Intronic
1119691169 14:76673891-76673913 TGCATGCCAGGTGCTGATCTTGG - Intergenic
1120349794 14:83341320-83341342 CATGGGCCAGGGGCTGTTCTGGG - Intergenic
1120401081 14:84032733-84032755 CAATTGCCAGGTAGTGTTCTAGG - Intergenic
1120493954 14:85210741-85210763 GACATACCAGGTTCTCTTCTTGG - Intergenic
1120537133 14:85710883-85710905 CACATGTAAGGTGATTTTCTTGG + Intergenic
1120572761 14:86142318-86142340 CATATGCCAGGTCCTGTGCCTGG + Intergenic
1120725296 14:87932294-87932316 CACATACCAGGGGCTGTTGGGGG + Intronic
1120792389 14:88597291-88597313 CACATGCCAGGGGCTACTCCAGG + Intronic
1120834663 14:89028746-89028768 CAAATCCCAGGTGATCTTCTGGG + Intergenic
1120981334 14:90291878-90291900 CACAGGACAAATGCTGTTCTAGG + Intronic
1121297889 14:92844523-92844545 TACGTGCCAGATACTGTTCTAGG - Intergenic
1121309376 14:92927019-92927041 CAGAGGCCAGAGGCTGTTCTAGG - Intronic
1121508007 14:94491106-94491128 TGTATACCAGGTGCTGTTCTAGG + Intronic
1121634234 14:95442958-95442980 CATATGCCAGGCAGTGTTCTAGG - Intronic
1122016881 14:98803825-98803847 CACTTGCCAGGTGCTGGGCTGGG - Intergenic
1122363007 14:101178512-101178534 CACGTACCAGGGGCTATTCTAGG + Intergenic
1122495884 14:102154683-102154705 AACATGCCAAGCACTGTTCTAGG - Intronic
1122896733 14:104761325-104761347 TATATGCCAGGTACTGCTCTAGG - Intronic
1122986850 14:105216425-105216447 CGCATGCCAGGAGCTGTGCTAGG + Intronic
1202878060 14_KI270722v1_random:26891-26913 CACATACCAGGGCCTGTTGTGGG - Intergenic
1123883127 15:24694204-24694226 CACACACCAGGTCCTGTTGTGGG + Intergenic
1124253685 15:28123884-28123906 TGCATGCCAGGCTCTGTTCTGGG - Intronic
1124356909 15:29002538-29002560 CATTTGCCATGTGCTGGTCTCGG + Intronic
1124421644 15:29528048-29528070 TACCTTCCAGGTGCTGTGCTAGG + Intronic
1124963374 15:34414809-34414831 CACATACCAGGTGCCACTCTGGG - Intronic
1124979995 15:34561035-34561057 CACATACCAGGTGCCACTCTGGG - Intronic
1125039959 15:35173950-35173972 CCTATGCCAGGTGCTGGTTTAGG + Intergenic
1125294902 15:38191926-38191948 CACGTGTCAGGTACTGTTCCAGG - Intergenic
1125645368 15:41268024-41268046 TACATGCCAGGTACTATTTTAGG + Intronic
1125796302 15:42406469-42406491 CACATTCCAGGCACTGTGCTTGG + Intronic
1126740308 15:51770434-51770456 CCCATGCCAGTTGCTGTGCCAGG - Intronic
1126896768 15:53266177-53266199 CACATGGCAGGGGGTGTTGTGGG - Intergenic
1126995917 15:54444975-54444997 CACACACCAGGGGCTGTTGTGGG - Intronic
1127428550 15:58880163-58880185 CAAATACCAGGCACTGTTCTTGG + Intronic
1127641824 15:60923375-60923397 TATGTGCCAGGTGCTGTGCTGGG - Intronic
1127732675 15:61815078-61815100 TACATGCCAGGCACTGTTCTAGG + Intergenic
1127952367 15:63821819-63821841 CACATGCTAGGGACTTTTCTAGG + Intronic
1128197026 15:65767394-65767416 TATTTGCCAGGTACTGTTCTAGG - Intronic
1128306913 15:66604756-66604778 TACATGCCAGGTTCTGTTCTAGG - Intronic
1128360792 15:66960200-66960222 CACCTGCCAGGGGCTGTCCTGGG - Intergenic
1128423149 15:67513888-67513910 CATATGCCAAGTACTGTTTTAGG + Intergenic
1128610182 15:69066874-69066896 CACATACCAGGCGCTGTTCTAGG - Intergenic
1128619550 15:69137314-69137336 CCCATGCCAGGTGTTGGACTCGG + Intergenic
1128917090 15:71572937-71572959 GGCATGCCAGGAGCTGTTCCTGG + Intronic
1129010665 15:72413694-72413716 CACATTCCAGGGCCTGTTGTGGG + Intergenic
1129569800 15:76668768-76668790 CATATGCCAGGCACAGTTCTAGG - Intronic
1129802866 15:78429616-78429638 CATATGCCAGGGCCTGTGCTAGG + Intergenic
1129815728 15:78551672-78551694 CACGTGCCAGTTTCTGTTCTAGG - Exonic
1130237531 15:82150464-82150486 TGTGTGCCAGGTGCTGTTCTGGG + Intronic
1130913861 15:88289866-88289888 TACCTGCAAAGTGCTGTTCTAGG - Intergenic
1130980410 15:88808394-88808416 TACATGCCAGGCACTGTGCTAGG + Intronic
1131076832 15:89500606-89500628 CACATGCCAGGCACTGTGCTGGG - Intergenic
1131105146 15:89728864-89728886 CACATTCTAGGTGCTGGTCCTGG - Intronic
1131216344 15:90539015-90539037 GATGGGCCAGGTGCTGTTCTCGG - Intronic
1131222241 15:90594652-90594674 CCCATGCCAGGCGCTGTGCTGGG + Intronic
1131254399 15:90852558-90852580 CTCATGCCAGGCGCTGGCCTGGG - Intergenic
1131284532 15:91046073-91046095 CACATACCAGGGCCTGTTGTGGG - Intergenic
1132056941 15:98658990-98659012 CAGGTGCCAGGTTCTATTCTAGG - Intronic
1132228571 15:100164434-100164456 TGCATGCCAGATCCTGTTCTAGG + Intronic
1132237676 15:100234347-100234369 CATATGCCAGGCGGTGTCCTGGG - Intronic
1132587397 16:711592-711614 CTGATGCCAGGTGCTTTCCTGGG + Intronic
1132761727 16:1511800-1511822 CATGTGCCAGGCGCTGTGCTGGG + Intronic
1132860037 16:2065917-2065939 TACTTCCCAGGTGCTGTGCTGGG - Intronic
1133752993 16:8739110-8739132 TGCATGCCAAGTGCTGTGCTGGG + Intronic
1134030825 16:10991003-10991025 CGTATGCCAGGCACTGTTCTAGG + Intronic
1134044651 16:11092399-11092421 CACATGCCAGGTGTGGTGGTGGG + Intronic
1134178285 16:12026412-12026434 CACATGCCAGGCACTGTTCTAGG - Intronic
1134298396 16:12967390-12967412 CACATACCAGGGACTGTTGTGGG + Intronic
1134358396 16:13506260-13506282 CACATGCCAGGCACAGTTCAAGG + Intergenic
1134666674 16:16023854-16023876 CACATGCCAGTTGCTCTACCAGG - Intronic
1134914384 16:18057757-18057779 GATATGCCAGGCACTGTTCTAGG + Intergenic
1135133864 16:19873531-19873553 CACAGGCCAAGTGCTGCACTGGG + Intronic
1135485601 16:22862111-22862133 TAAGTGCCAGGTGCTGTACTTGG - Intronic
1135608895 16:23847634-23847656 CACATATCAGGTACTGTTCTAGG + Intronic
1135902931 16:26482863-26482885 CACATGTCAAGCACTGTTCTAGG + Intergenic
1135903383 16:26487604-26487626 CACATGTCAAGCACTGTTCTAGG + Intergenic
1135922046 16:26659679-26659701 CATATGCCAGAATCTGTTCTGGG - Intergenic
1136023820 16:27457099-27457121 CAGATGCCAGACACTGTTCTGGG - Intergenic
1136282212 16:29220554-29220576 CACGTGCCGGGAGCTGATCTTGG + Intergenic
1137463421 16:48686547-48686569 TGCAAGCCAGGTACTGTTCTAGG + Intergenic
1137599683 16:49748160-49748182 TACGTGCCAGGCACTGTTCTAGG - Intronic
1137731034 16:50690662-50690684 TGCATGCCAGGTCCTGTTCTAGG + Intergenic
1137765045 16:50971589-50971611 CACATGCCAAGTCCTGTGCCAGG + Intergenic
1137802056 16:51270593-51270615 CATATGCCAGGTCCTGTTTCAGG + Intergenic
1138333178 16:56231513-56231535 AACATGCCAGGTACTCTTCTAGG - Intronic
1138890631 16:61140086-61140108 CACATACCAGGGCCTGTTGTGGG - Intergenic
1139223137 16:65205286-65205308 TACATGCCAGGAAATGTTCTGGG + Intergenic
1139314879 16:66059611-66059633 CACATTCCAGGCACTGTGCTGGG - Intergenic
1139397801 16:66654377-66654399 CACATGGCAGGTGCTCTCCAGGG + Intronic
1139486448 16:67259445-67259467 GACATGCCAGGTACTCTGCTAGG - Intronic
1139492603 16:67294431-67294453 CAGAAGCCAGGTCCTGTCCTAGG + Intronic
1140088544 16:71818187-71818209 CACATGCCAGCTGATGGTCTAGG + Intergenic
1140432693 16:74918126-74918148 CATATGCCAGGCACTATTCTAGG + Intronic
1140675451 16:77324467-77324489 TATATACCAAGTGCTGTTCTTGG + Intronic
1140732584 16:77870152-77870174 CACGTGCTGGGTGCTGTGCTTGG + Intronic
1140787585 16:78357709-78357731 CACATGCCAGGCACAGTGCTGGG + Intronic
1141197001 16:81867583-81867605 CAGGTGACAGGTGTTGTTCTAGG - Intronic
1141197611 16:81872595-81872617 CACCTACCAGGTACTGTGCTAGG - Intronic
1141284556 16:82659642-82659664 CACAGGCCAGGTACTGTGCGAGG + Intronic
1141516175 16:84546805-84546827 CCCATGCCTGGAACTGTTCTTGG + Intronic
1141652346 16:85399798-85399820 CACCTGCCAGGGGCTCTTCTAGG - Intergenic
1141776830 16:86128666-86128688 CACGTACCAGCTGCTGTTCAGGG - Intergenic
1142086584 16:88186472-88186494 CACGTGCCGGGAGCTGATCTTGG + Intergenic
1142233944 16:88912658-88912680 CGTGTGCCAGGTGCTGTTCAGGG - Intronic
1142270587 16:89087189-89087211 CACATTCCAGGCACTGTCCTAGG + Intergenic
1142430205 16:90022391-90022413 CACGTGCTGTGTGCTGTTCTAGG + Intronic
1142612471 17:1116789-1116811 CGTGTGCCAGGTGCTGTGCTAGG - Intronic
1143386423 17:6533872-6533894 CAAGTGCCAGGTGCTCTTCTGGG - Intronic
1143396172 17:6599480-6599502 CAAATGCCATGTGTTGATCTTGG + Intronic
1143461231 17:7105376-7105398 AACCTGCCAGGTGCAGTTTTTGG + Intronic
1143556690 17:7666405-7666427 CCTGTGCCAGGAGCTGTTCTAGG - Intronic
1143731191 17:8883851-8883873 CACAGCCCAGGCACTGTTCTAGG - Intronic
1143787323 17:9265710-9265732 CACCTGCCAGGCACTGTTCTAGG + Intronic
1143831521 17:9655715-9655737 CACACGCCAGGCACTATTCTAGG - Intronic
1144656228 17:17038899-17038921 TTCATGCAAAGTGCTGTTCTAGG + Intergenic
1145205608 17:20983641-20983663 TATGTGCCAGGTGCTGTGCTGGG + Intergenic
1145765039 17:27453119-27453141 TACATGGCAGGCCCTGTTCTGGG - Intergenic
1145800483 17:27680495-27680517 TAAGTGCCAGGTGCTGTACTAGG + Intergenic
1145830235 17:27910345-27910367 TACATGCCAGGCACTGCTCTGGG + Intergenic
1146173171 17:30648357-30648379 TTCATGCCAGGTGCCGTGCTGGG + Intergenic
1146374848 17:32287170-32287192 CACATGCCCAGTGCTGTGCTGGG - Intronic
1146442800 17:32911846-32911868 TTCATGCCAGGTACTGTGCTAGG - Intergenic
1146482349 17:33214802-33214824 TGCATGCCAGCTGCTGTGCTAGG + Intronic
1146515544 17:33486443-33486465 CGTATGCCAGGTGCTGTACCAGG - Intronic
1146926140 17:36747002-36747024 TAGATGCCATGTGCTGTACTTGG + Intergenic
1146939362 17:36833507-36833529 CGGGAGCCAGGTGCTGTTCTAGG + Intergenic
1147240984 17:39090404-39090426 CACAGGCCAGATGCTGCTCCAGG + Intronic
1147373272 17:40008594-40008616 CCCATGCCAAGCACTGTTCTGGG + Intergenic
1147764346 17:42823836-42823858 CACCTGCATGGTGCTGTTGTTGG + Exonic
1147841900 17:43377706-43377728 CACAAGCCAAATGCTGTTGTAGG + Intergenic
1147880292 17:43649113-43649135 GACATGCCAGGCACTGTGCTAGG - Intronic
1148339908 17:46867212-46867234 CATGTGCCAGGTACTGTGCTGGG - Intronic
1148522324 17:48290705-48290727 TATGTGCCAGGTACTGTTCTAGG - Intronic
1148785304 17:50143428-50143450 GCCATGCCAGGTGCTGTTCCAGG - Intronic
1148843617 17:50515356-50515378 TACATGCCAGGCACTGTGCTAGG - Intronic
1149053317 17:52332796-52332818 CACATACCGGGTTCTGTTGTGGG - Intergenic
1149418723 17:56487600-56487622 TATATGCCAGGTACTGTGCTGGG + Intronic
1149536121 17:57434896-57434918 AACATGTCAGGTGCTGTGTTAGG + Intronic
1149903174 17:60500689-60500711 CATGTTCCAGGTACTGTTCTAGG - Intronic
1150091618 17:62331529-62331551 CACATGCCAGGCATTGTTCCAGG + Intergenic
1150182373 17:63137723-63137745 CATATGCCAGATACTATTCTAGG + Intronic
1150634971 17:66906525-66906547 TGCATGCCAGAGGCTGTTCTAGG + Intergenic
1150889006 17:69122994-69123016 CACACACCAGGGACTGTTCTGGG + Intronic
1150952928 17:69822588-69822610 GACATGCCAGGTGCTGCAGTGGG - Intergenic
1151813243 17:76457704-76457726 CCTATGCCAGGTACTGTCCTAGG - Intronic
1152877552 17:82795765-82795787 CACCTGCCACGTGGTCTTCTCGG - Intronic
1153017361 18:596312-596334 CCCATGCCAGGTGCTGTCCTTGG - Intergenic
1153162388 18:2222196-2222218 TACCAGCCAGGTGCTGCTCTAGG - Intergenic
1153381895 18:4449587-4449609 TAAGTGCCAGGTGCTGTGCTAGG + Intronic
1153662056 18:7333776-7333798 CACATGCCAGGTGCAGAGCGGGG + Intergenic
1154330430 18:13425047-13425069 TACATGCCAGAAACTGTTCTGGG + Intronic
1155759140 18:29542964-29542986 CATATGCTAGGCACTGTTCTAGG + Intergenic
1156219429 18:35036832-35036854 TATCTGCCAGGTCCTGTTCTAGG + Intronic
1156810046 18:41237922-41237944 CACACGCCAGGGCCTGTTGTGGG + Intergenic
1156907637 18:42373324-42373346 TATATGCCAGGTACAGTTCTCGG + Intergenic
1157029417 18:43887332-43887354 TAGATGCCAGGTACTGTTCTAGG - Intergenic
1157171879 18:45414712-45414734 CACATGCCAGGTGCGGTGCAAGG + Intronic
1157947247 18:51994061-51994083 TATATGCCAGGTACTGCTCTAGG - Intergenic
1158071145 18:53471985-53472007 CATGTGCCAGGTGCTGTTCTGGG - Intronic
1158720364 18:59919169-59919191 AGCATGCCAGGTGCTTTGCTGGG + Intergenic
1159135880 18:64336415-64336437 AACATGCCAGGTGCTTTACTAGG - Intergenic
1159532678 18:69674869-69674891 CATATGCCAGGCACTGTGCTAGG - Intronic
1159758810 18:72399046-72399068 CACACGCCAGGGCCTGTTGTGGG + Intergenic
1159903238 18:74067328-74067350 TACATTCCTGATGCTGTTCTTGG + Intergenic
1159954179 18:74507751-74507773 CACAGTACAGGTGCTCTTCTAGG - Intronic
1159977330 18:74730068-74730090 CATGTGCCAGGCGCTATTCTTGG + Intronic
1160000135 18:75010426-75010448 CACATGACTGTTGCTGTTTTTGG - Intronic
1160048989 18:75414339-75414361 TACATGCCAAGTACTGTGCTAGG + Intronic
1160301436 18:77684321-77684343 TATATGCCAGGTATTGTTCTAGG + Intergenic
1160515855 18:79478838-79478860 CCCATGCCTGGTGCTGTTCTGGG - Intronic
1160740430 19:683047-683069 CACCAGCCAGGTGCTGGTCTTGG + Exonic
1161278058 19:3429918-3429940 CGGTTGCCAGGCGCTGTTCTCGG + Intronic
1161499157 19:4603832-4603854 TGCATGCCAGGTGCTCTTCTAGG + Intergenic
1161541998 19:4857612-4857634 TACAAGCCATGTGCTGTTCTGGG + Intronic
1161630691 19:5353827-5353849 CAAGTGCCAGGTACTGTTCTAGG + Intergenic
1161839501 19:6670416-6670438 CCCATGCCAGGCTCTGCTCTCGG + Exonic
1162036449 19:7942488-7942510 AACACGCCAGGTTCTGTGCTGGG - Intronic
1162549236 19:11349320-11349342 TGAGTGCCAGGTGCTGTTCTAGG - Intronic
1162667820 19:12230013-12230035 CTCTTGCCATTTGCTGTTCTTGG + Intronic
1162989247 19:14291704-14291726 TTCATGCCAGGTGCCGTGCTGGG - Intergenic
1163204030 19:15789191-15789213 CAAATGCCTGGTGCTCATCTGGG - Intergenic
1163304240 19:16467760-16467782 CACTGGCCGGGTGCTGCTCTGGG + Intronic
1163394330 19:17050349-17050371 TTCATGTCTGGTGCTGTTCTTGG - Intronic
1163757263 19:19113497-19113519 CACAGGCCTGGTGCTCTTGTTGG + Intergenic
1163842229 19:19618498-19618520 CACAGGCCAGGTGCTGCCCGCGG - Exonic
1164131658 19:22368807-22368829 CACATGCCACTTGCAGATCTTGG + Intergenic
1164578529 19:29419896-29419918 CACGTGCCAGGCACTGTGCTAGG - Intergenic
1164798681 19:31057826-31057848 TACATGCCATGTACTGTTCTTGG + Intergenic
1164859885 19:31554578-31554600 CACGTGCCAGGCTCTGTTCTAGG - Intergenic
1165006798 19:32814132-32814154 CACGTGCCAGGAGCAGTGCTGGG + Intronic
1165132904 19:33644320-33644342 TGCATGTCAGGTACTGTTCTAGG + Intronic
1165346419 19:35251171-35251193 CATATACCAGGTGCTGTTCTGGG + Intronic
1165354727 19:35296398-35296420 CACGTGCCAGGTGCTGCTCTGGG - Intronic
1165432666 19:35781443-35781465 CACGTGCCAGGCACTGTTCTAGG + Intronic
1165445137 19:35852608-35852630 CACATGCCAGGCGCGTTCCTCGG + Intronic
1165471174 19:36005618-36005640 TACAAGCCAGGAACTGTTCTAGG + Intronic
1165714500 19:38035675-38035697 CTCGTGCCAGGTACTGTCCTAGG - Intronic
1165781802 19:38439064-38439086 CATGGGCCAGGTGCTGTTCTAGG - Intronic
1165857580 19:38889214-38889236 CGCATGCCAGGAACTGTTCTAGG + Intronic
1165896300 19:39143223-39143245 CAGGTGCCAGGCACTGTTCTAGG - Intronic
1166335415 19:42103359-42103381 TGGGTGCCAGGTGCTGTTCTAGG - Intronic
1166669110 19:44699165-44699187 TGTTTGCCAGGTGCTGTTCTAGG - Exonic
1166719419 19:44988636-44988658 CACATGCCAGGCACTGTCCTGGG + Intronic
1166726732 19:45033012-45033034 CACATGCCCGGGCCTGTGCTCGG + Intronic
1166800994 19:45456889-45456911 TTTCTGCCAGGTGCTGTTCTAGG + Intronic
1167002200 19:46752467-46752489 AACATGCCAGGCACTGTTCTAGG - Intronic
1167011164 19:46809123-46809145 TATATGCCAGGTGCTTTTCTAGG - Intergenic
1167078824 19:47265452-47265474 CACATGGCAGGTGCTGTGTGAGG + Intronic
1167158751 19:47754714-47754736 CACATTCCAGGAGCTGTGCGAGG + Exonic
1167217952 19:48177409-48177431 CAGACGCCAGGTACTATTCTAGG + Intronic
1167397978 19:49244008-49244030 TACATGCCAGGTTCGGTTCTGGG + Intergenic
1167551547 19:50164331-50164353 TATGTGCCAGGTGCTGTTCAAGG + Intergenic
1168061438 19:53894782-53894804 CATAAGCCAGGCCCTGTTCTGGG + Intronic
1168073493 19:53965524-53965546 TAGATGCCACGTGCTGTCCTAGG - Intronic
1168407636 19:56119250-56119272 CACAGGCCAGGCCCTGTGCTGGG - Intronic
1168466619 19:56607442-56607464 TAAGTGCCAGGCGCTGTTCTAGG + Intronic
1168557264 19:57353512-57353534 CACTTGCCTGGTTCTGCTCTGGG + Intronic
924999384 2:392918-392940 CACATGCCAGGTTCTATGTTAGG - Intergenic
925112678 2:1349720-1349742 CAGATGCCAGGGACTGTGCTGGG + Intronic
925740361 2:7000156-7000178 CATGTTCCAGGTGCTGTGCTAGG + Intronic
925875225 2:8305719-8305741 CAAATACCCAGTGCTGTTCTTGG - Intergenic
926602862 2:14864847-14864869 TACATGGCAGGTTCTGTTCTAGG - Intergenic
926616752 2:15003387-15003409 CAAGTGCCAGGTGTGGTTCTAGG + Intergenic
926856056 2:17257133-17257155 TAGATGCCAGGTACTATTCTGGG - Intergenic
926925510 2:17983290-17983312 CACACGCCAGGGCCTGTTGTGGG - Intronic
927162885 2:20285669-20285691 CACATGCCAGCCACTATTCTAGG + Intronic
927846077 2:26473555-26473577 CCTCTCCCAGGTGCTGTTCTGGG - Exonic
928213427 2:29341012-29341034 CAGGTGCTAGGTGTTGTTCTAGG - Intronic
928375419 2:30769589-30769611 CATATGCCAGGCACTGTGCTTGG - Intronic
928615196 2:33031437-33031459 CACATACCAACTACTGTTCTAGG + Intronic
928705540 2:33945900-33945922 TCCATCCCAGGTGTTGTTCTAGG + Intergenic
928840221 2:35597199-35597221 CACATACCAGGGCCTGTTGTGGG - Intergenic
929464009 2:42128600-42128622 CATATGCCTGGCACTGTTCTAGG - Intergenic
929467979 2:42163037-42163059 CATGTGCCAGGTGCTCTTCTAGG + Intergenic
929624318 2:43390791-43390813 TACGTGCCAGGCACTGTTCTGGG - Intronic
929915214 2:46129507-46129529 CACGTGACATGCGCTGTTCTTGG - Intronic
930235044 2:48880759-48880781 CACATGGCTGGTGCTGTTCTTGG + Intergenic
930591936 2:53337989-53338011 CAAATCCCAGCTGCTGTTTTGGG - Intergenic
930695681 2:54409378-54409400 CACATGCTTGTTGCTGTTCTTGG - Intergenic
930870105 2:56161962-56161984 CACATGCCGGGGCCTGTTGTGGG - Intergenic
931289167 2:60857422-60857444 TATGTGCCAGGTACTGTTCTAGG + Intergenic
931563850 2:63592794-63592816 TACAGGACAGGTGTTGTTCTAGG + Intronic
931599559 2:63989996-63990018 AACATTCCAGGAGCTGTTCCCGG + Intronic
931704841 2:64938660-64938682 TAGATGCCAGGTGCTGCTCTAGG + Intergenic
931950386 2:67355674-67355696 CACATGTCAGGCACTGTTGTAGG + Intergenic
932043058 2:68319813-68319835 CTCCTGCCCGGGGCTGTTCTAGG - Exonic
932086639 2:68768476-68768498 CAATTGCCAGATGCTTTTCTAGG + Intronic
932160059 2:69451741-69451763 TGAATGACAGGTGCTGTTCTAGG - Intergenic
932180291 2:69640954-69640976 GAAGTGCCAGGTGCTGTGCTAGG - Intronic
932399474 2:71469967-71469989 TACGTGCCTGGTGCTTTTCTAGG + Intronic
932527299 2:72484610-72484632 CACATACCAGGGCCTGTTGTGGG - Intronic
932681215 2:73827463-73827485 TATGTGCCAGGTTCTGTTCTAGG - Intergenic
933048630 2:77573259-77573281 CACACACCAGGTCCTGTTGTGGG - Intronic
933117437 2:78492566-78492588 CACATACCAGGGACTGTTGTTGG - Intergenic
933125449 2:78598670-78598692 CATATGGCAGGAACTGTTCTGGG - Intergenic
933733076 2:85472603-85472625 CACATACCAGGCCCTGTTGTAGG - Intergenic
933885770 2:86718903-86718925 CTCACGCCAGGGGCTGTTCTAGG + Intronic
933924408 2:87077802-87077824 CTCATGCCAGGGGCTGTTCTAGG - Intergenic
934168813 2:89321837-89321859 CTCATTCCAGGTGCTGTGATAGG - Intergenic
934198478 2:89860747-89860769 CTCATTCCAGGTGCTGTGATAGG + Intergenic
934531414 2:95091536-95091558 CATTTGCCAGGTACTGCTCTGGG - Intronic
934584802 2:95482183-95482205 TGAGTGCCAGGTGCTGTTCTAGG - Intergenic
934594653 2:95594533-95594555 TGAGTGCCAGGTGCTGTTCTAGG + Intronic
934788121 2:97031105-97031127 TGAGTGCCAGGTGCTGTTCTAGG - Intergenic
935016289 2:99185355-99185377 CACATGCCAGGTACTGTTTTAGG + Intronic
935058970 2:99591946-99591968 CCCATGACAGATGCTGCTCTAGG - Intronic
935405642 2:102706406-102706428 CACACGCCAGGGCCTGTTGTGGG + Intronic
935531470 2:104237687-104237709 CACATGCCTGGATCTCTTCTGGG - Intergenic
936489786 2:112960287-112960309 CATGTGCCAAGTACTGTTCTAGG - Intergenic
936943045 2:117905292-117905314 CACACGCCAGGGCCTGTTGTGGG - Intergenic
937063206 2:118995502-118995524 CACACACCAGGGGCTGTTGTGGG - Intergenic
937203705 2:120222901-120222923 CACCTGCCTGCTGCTCTTCTCGG - Exonic
937224001 2:120357788-120357810 CACAGCCCAGGTCCTGCTCTGGG + Intergenic
937566940 2:123305203-123305225 TGCATGTCAGTTGCTGTTCTAGG + Intergenic
937811545 2:126204967-126204989 GACATGGAAGGTGCTGATCTGGG + Intergenic
937845593 2:126575465-126575487 TGTATGCCAGATGCTGTTCTAGG - Intergenic
938093708 2:128448630-128448652 CACTGGCCAGGCACTGTTCTGGG - Intergenic
938136050 2:128757531-128757553 CGTGTGCCAGGTGCTGTTCTTGG - Intergenic
938144427 2:128821849-128821871 CTCAGGCCAGGTGCTGCTCCAGG + Intergenic
938812606 2:134867507-134867529 CAGATACCAGGTACTGTTTTGGG - Intronic
938841780 2:135171672-135171694 TATGTGCCAGGTACTGTTCTAGG + Intronic
939601962 2:144203638-144203660 CAGACACCAGGTGCTTTTCTGGG - Intronic
940068200 2:149653613-149653635 TGCATGCCAGGTACTGTTGTAGG + Intergenic
940275351 2:151934409-151934431 CACCTACCAGATACTGTTCTAGG + Intronic
941369249 2:164643819-164643841 TGAATGCCAGGTGCTGTTCTAGG - Intergenic
941463417 2:165797144-165797166 TAAGTGCCAGGTGCTGGTCTTGG - Intergenic
941475513 2:165947030-165947052 AACATGCCAGCTACTGTTATGGG + Intronic
941649601 2:168079477-168079499 CACTTGACTGGTGCTCTTCTTGG - Intronic
941733587 2:168947371-168947393 TACATCCCAAGTGCTGTGCTTGG + Intronic
941913706 2:170793287-170793309 CACATGCCAGCCACTGTTCCAGG + Intronic
941964309 2:171285698-171285720 TATATGCCAGGCGCTATTCTTGG - Intergenic
942070425 2:172311158-172311180 CAAGTGCCAGGCACTGTTCTGGG + Intergenic
942296959 2:174527261-174527283 TACATGCTAGGTACTGTTCTAGG + Intergenic
942828086 2:180204779-180204801 CATATGCTAGGCACTGTTCTAGG + Intergenic
943584121 2:189717918-189717940 CACATACCAGGGCCTGTTCTGGG + Intronic
944216306 2:197259667-197259689 AACGTGCCAGGTGCTGAGCTTGG + Intronic
944490318 2:200252093-200252115 TACATACCAGGTGCAGTTTTAGG - Intergenic
944612659 2:201427333-201427355 CACATACCAGGGCCTGTTTTGGG - Intronic
945132271 2:206585668-206585690 CACATGCCTGGTGTTGTTGTAGG + Intronic
945243057 2:207694142-207694164 TATGTGACAGGTGCTGTTCTAGG - Intergenic
945308787 2:208286184-208286206 TACATGCCATGCGCTGTTCTTGG - Intronic
945808949 2:214524591-214524613 CATGTGCCAGGCGCTGTTTTAGG + Intronic
945834336 2:214821257-214821279 TACATCCCTGGTGCTGTCCTAGG - Intergenic
945969160 2:216219408-216219430 CATATTTCAGGTGCTGTTCTAGG - Intergenic
946239267 2:218344049-218344071 CACATACCAGGCTCTGTTCCAGG + Intronic
946574627 2:221061374-221061396 TACATACCAGGTACTATTCTAGG + Intergenic
946832822 2:223743207-223743229 CAAATGTTAGCTGCTGTTCTTGG - Intergenic
947073796 2:226319538-226319560 TATGTGCCAGGTACTGTTCTGGG - Intergenic
947595558 2:231409579-231409601 CAGAAGCCAGGTCCTGCTCTGGG + Intergenic
947902304 2:233731445-233731467 CACACGCCAGGGCCTGTTGTGGG - Intronic
948234216 2:236375348-236375370 CACGTGCCAGGCACTGTACTCGG + Intronic
948620039 2:239228459-239228481 CACGTGAAAGGTGGTGTTCTTGG + Intronic
948929422 2:241122598-241122620 CACATGCCAGGTTGTGTGCTTGG + Intronic
1168849172 20:965064-965086 TGTATGCCAGGTGCTATTCTGGG + Intronic
1169274352 20:4223458-4223480 TCCCTGCCAGGTGCTGTGCTGGG + Intronic
1169335310 20:4751052-4751074 CACATGTCAGGTACTGTTCTAGG - Intergenic
1169754065 20:9024638-9024660 AATATGCCAGGCACTGTTCTAGG - Intergenic
1169870240 20:10241412-10241434 TACATGCCTAGTGCTGCTCTGGG + Intronic
1170677179 20:18493298-18493320 CATATGCCAGGCTCTCTTCTAGG + Intronic
1171289632 20:23974788-23974810 CACATGCCATGAGCTCTGCTGGG + Intergenic
1171976318 20:31596916-31596938 CACATGCCAGGTGCTGCATGAGG + Intergenic
1172060302 20:32182814-32182836 CTTGTGCCAGGTGCTGCTCTAGG + Intergenic
1172315255 20:33949032-33949054 CACATGCCAGGTCCCCTTCTGGG + Intergenic
1172384353 20:34523222-34523244 GCCCTGCCAGGTGCTGCTCTCGG - Intronic
1172460935 20:35118134-35118156 CACATGCCAGGCACTCTGCTAGG - Intronic
1172523130 20:35582188-35582210 CTGACCCCAGGTGCTGTTCTGGG - Intergenic
1172744078 20:37193247-37193269 CACATGCCAGGTGCTGTTCTAGG - Intronic
1172777706 20:37417068-37417090 TACATGCCAGGCGCTGTTCTAGG - Intergenic
1172908099 20:38384552-38384574 TATGTGCCAGGTGCTGTTCTAGG - Intergenic
1173162005 20:40659821-40659843 CACATGCCTGGTACTGTTCTAGG + Intergenic
1173289217 20:41699882-41699904 CACGTGCCAGGTTCTGTGCTAGG - Intergenic
1173354099 20:42270675-42270697 GACATGCCAGGTACTTTTCTGGG + Intronic
1173653506 20:44682873-44682895 GACATGCCAGGTACGGTGCTGGG + Intergenic
1173669879 20:44791492-44791514 CACATTCCAGATGCCGTGCTAGG - Intronic
1173799644 20:45886976-45886998 CACAAGCCAGGGGCTGCCCTGGG - Exonic
1173827015 20:46054667-46054689 CATATGCCTGGTCCTGTGCTGGG + Intronic
1173982431 20:47235214-47235236 TACATGCCAGGCATTGTTCTAGG + Intronic
1174005161 20:47404812-47404834 TATATTCCAGGTCCTGTTCTAGG + Intergenic
1174058551 20:47816390-47816412 CACATGCCAGGTACTCTGCTAGG - Intergenic
1174266572 20:49336344-49336366 CATGTGCTAGGTACTGTTCTGGG + Intergenic
1174280410 20:49434988-49435010 AACATGCCAGGCACTGTACTAGG - Intronic
1174506112 20:51018634-51018656 TAAGTGCCAGGTGCTGTGCTAGG + Intronic
1174703099 20:52629144-52629166 TACTTGCCAGGTGCTGTGCTAGG + Intergenic
1174748633 20:53089507-53089529 TACATGCCAGGCACTGTACTTGG + Intronic
1174854143 20:54026865-54026887 AAGATGCCAAGTGCTGTGCTGGG - Intronic
1174894487 20:54434384-54434406 CACATGTCTGGCACTGTTCTAGG - Intergenic
1174933392 20:54841039-54841061 CACATGCCAGGGACTATCCTGGG + Intergenic
1175072346 20:56345126-56345148 CAAATGCCAGGTTTTCTTCTTGG + Intergenic
1175209481 20:57341970-57341992 CATTTGCCAGGGGCAGTTCTTGG - Intronic
1175335902 20:58196169-58196191 TACGTGCCAGGTGCTGTTCTGGG - Intergenic
1175365863 20:58455710-58455732 CATGTGCCAGGTGCTATGCTGGG - Intergenic
1175538504 20:59732815-59732837 CACCTGCCAGGCACTGTGCTAGG + Intronic
1175702195 20:61147639-61147661 CACATGCCAGGCACTGGGCTTGG + Intergenic
1176018718 20:62952078-62952100 CACAGGCCAGGTTCTGGGCTCGG - Intergenic
1176359924 21:5986645-5986667 TACGTGCCAGGTCCTGTTCTAGG + Intergenic
1178413357 21:32383966-32383988 TACATGCAAGGCCCTGTTCTAGG + Intronic
1178617619 21:34147304-34147326 CATATGGCAGGTGCTGCTCTGGG + Intergenic
1178690089 21:34743326-34743348 CACCTGCCTGGAGGTGTTCTTGG + Intergenic
1179001452 21:37463650-37463672 CATGTGCCAGGCACTGTTCTTGG + Intronic
1179009871 21:37548040-37548062 CACAGGCCAGATACTGTGCTGGG - Intergenic
1179237068 21:39557053-39557075 CACATACCAGGGCCTGTTGTGGG - Intronic
1179344801 21:40546555-40546577 TCCATGCCAGGAGCTGTGCTTGG - Intronic
1179489405 21:41730447-41730469 TACATGCCAGCTGCTGGACTAGG - Intergenic
1179584551 21:42366292-42366314 TTTGTGCCAGGTGCTGTTCTAGG - Intronic
1179763594 21:43551905-43551927 TACGTGCCAGGTCCTGTTCTAGG - Intronic
1180458280 22:15533200-15533222 CACACGCCAGGGCCTGTTGTGGG - Intergenic
1180596321 22:16975770-16975792 CATCTGGCAGGTGCTGCTCTGGG + Intronic
1181106568 22:20579269-20579291 CTCATCCCAGGTGCTGGACTTGG + Intronic
1181106719 22:20579992-20580014 CTCATCCCAGGTGCTGGACTTGG + Intronic
1181639926 22:24190979-24191001 CACCTGCCAGGGGCTTTTCCTGG + Intergenic
1181748766 22:24974344-24974366 GACATGCCAGGTACTGTGTTAGG + Intronic
1181902141 22:26165267-26165289 CATATGTCAGGCACTGTTCTGGG - Intergenic
1182044446 22:27263233-27263255 CAGATGCTAGGTGATGTACTAGG - Intergenic
1182089526 22:27584526-27584548 CATGAGCCAGGCGCTGTTCTAGG - Intergenic
1182214307 22:28703098-28703120 CATGTGCCAGGTGCTCTGCTGGG + Intronic
1182351222 22:29701056-29701078 AAAATGCCAGGTGCTATTCTGGG - Intergenic
1182352424 22:29706340-29706362 TACGTGCCAGGTGCTGTGCTGGG - Intergenic
1182424448 22:30264730-30264752 CACCTGCCAGGCTCTGGTCTAGG - Intronic
1182715127 22:32352249-32352271 CACATACCAGGGCCTGTTGTGGG + Intergenic
1182742460 22:32578054-32578076 TACATGCCAGGCACTATTCTAGG - Intronic
1182764656 22:32750061-32750083 TAAGTGCCAGGTCCTGTTCTAGG + Intronic
1182829704 22:33295047-33295069 CTCGTGGCAGGTGCTGTGCTAGG - Intronic
1182851615 22:33479301-33479323 CAGGTGCCAGATGCTGTGCTAGG - Intronic
1182901186 22:33899476-33899498 CACTTGCCACCTGCAGTTCTGGG - Intronic
1183067381 22:35372363-35372385 CACGGGCCAGGCGCTGTGCTGGG + Intergenic
1183154534 22:36065152-36065174 TACATGCTAGGTTCTGTGCTAGG + Intergenic
1183245602 22:36691055-36691077 CCATTGCCAGGTGCTGTCCTAGG - Intronic
1184113333 22:42408244-42408266 TACATTCCAGGCCCTGTTCTAGG - Intronic
1184234579 22:43176220-43176242 CACGTGCCAAGCACTGTTCTGGG + Intronic
1184330845 22:43826446-43826468 CACGTGCCAGGTGCCGTTCTAGG - Intronic
1185128304 22:49023808-49023830 CACATGCCAGCTGGGGTGCTGGG - Intergenic
1185308285 22:50135813-50135835 TACATGCCAGGTATTGTCCTGGG + Intronic
1185414478 22:50702316-50702338 GACGTGCCAGGTGCTGTGCTGGG + Intergenic
949672817 3:6419136-6419158 AATGTGCCAGGTGCTATTCTAGG - Intergenic
949674145 3:6433527-6433549 CACATGCCAGGTACTATGGTAGG - Intergenic
950251775 3:11471443-11471465 TACATGCCAGGTGTTATGCTAGG - Intronic
950315925 3:12002353-12002375 TACATGCCAGGTCCTGTGTTTGG + Intergenic
950455536 3:13090727-13090749 CATGTGCCAGGTGCTCTGCTGGG + Intergenic
950578319 3:13846420-13846442 CAGCTGGCAGGTGCTGTGCTGGG - Intronic
950983230 3:17331577-17331599 TCTATGCCAGGTGCTGTTCAGGG + Intronic
950985783 3:17364352-17364374 CACATGCCAGGTTCAGTTTAGGG + Intronic
951000371 3:17552536-17552558 CACATGCCTGGCACTATTCTAGG + Intronic
951546985 3:23836384-23836406 CACATGCCATGTGCTGTACTGGG + Intronic
951731819 3:25817965-25817987 ACTATGTCAGGTGCTGTTCTAGG - Intergenic
951788938 3:26458306-26458328 TACATGCCAGGCACTATTCTAGG - Intergenic
951850090 3:27129705-27129727 CACATGCCAGGCACTGTGCAAGG + Intronic
951989071 3:28655727-28655749 CACATGGAAGGTGCTGCTCATGG - Intergenic
952002671 3:28804604-28804626 TATATGCCAGGCTCTGTTCTAGG - Intergenic
952067260 3:29585604-29585626 CACATGTCGGTTGCTGTGCTAGG - Intronic
952069701 3:29619135-29619157 CACACGCCAGGGCCTGTTGTGGG + Intronic
952079702 3:29743364-29743386 CACTTGCTATGTGCTATTCTTGG - Intronic
952526471 3:34215841-34215863 CACATGCTAGGTCCTGGTCCTGG + Intergenic
952839010 3:37628553-37628575 GAGATGCCAGGTACTGTGCTAGG - Intronic
952890878 3:38039708-38039730 CAGGTGCCAGGCGCTGTTCCAGG + Intronic
953075683 3:39568201-39568223 AACATGCCAGATACTTTTCTGGG - Intergenic
953631716 3:44623807-44623829 CATATGCCAAATACTGTTCTGGG - Intronic
953747313 3:45585120-45585142 CATGTGCCAGGCACTGTTCTAGG + Intronic
953964617 3:47294292-47294314 CATGTGCCAAGTACTGTTCTAGG + Intronic
953964661 3:47294653-47294675 CACATGCAAGGAACTGTGCTGGG - Intronic
954212539 3:49106178-49106200 CACATGCCAGGTGCAGACCAGGG + Intergenic
954908806 3:54086136-54086158 CACGTGCCAGGCCCTGTGCTAGG - Intergenic
954973656 3:54672995-54673017 CACATGCCAGCTTCTGTTGATGG + Intronic
955053492 3:55435093-55435115 TACATGCCAGGTACTGTTTAAGG - Intergenic
955102710 3:55867322-55867344 CACATGCCAGGCCCTGTGCTAGG - Intronic
955273386 3:57524352-57524374 TATGTGCCAGGTACTGTTCTAGG - Intronic
955689029 3:61572607-61572629 AGCATGCCAGGTGCTGTTCTAGG + Intronic
955786007 3:62539649-62539671 TACGTGCCAGGTACTATTCTAGG - Intronic
955817961 3:62866416-62866438 TACATGTCAGGTACTGTTTTGGG + Intronic
955842125 3:63123791-63123813 GTAGTGCCAGGTGCTGTTCTTGG - Intergenic
955958821 3:64318129-64318151 CACATGCCAGGCACTGGGCTTGG + Intronic
955958842 3:64318377-64318399 TATATGCCAGGAACTGTTCTAGG + Intronic
956012312 3:64844777-64844799 TACATGTCTGGTGCTGTTCTAGG - Intergenic
956058095 3:65321946-65321968 AATGTGCCAGGTACTGTTCTGGG + Intergenic
956152892 3:66261718-66261740 CATGTGCCAGTTGCAGTTCTGGG + Intronic
956159125 3:66329994-66330016 TATGTGCCAGATGCTGTTCTAGG + Intronic
956197106 3:66664001-66664023 CACATGCCAGGTGCTGTGCTAGG + Intergenic
956251481 3:67238898-67238920 AAAATGCCAGGCACTGTTCTAGG - Intergenic
956478671 3:69651023-69651045 CATCTGCCAGGTGCTGTATTGGG + Intergenic
956499262 3:69864372-69864394 TACATGCCAGGTACTGTACCAGG - Intronic
956898300 3:73686339-73686361 TACATGCCAGGTACTGTGCTAGG - Intergenic
956994939 3:74815321-74815343 TATATGCCAGCTGCTGTGCTAGG - Intergenic
957103134 3:75852762-75852784 CACATGCCATGGCCTGTTGTGGG + Intergenic
957244052 3:77695971-77695993 CACATACCAGGGCCTGTTGTGGG + Intergenic
957244281 3:77698097-77698119 CACATGCCGGGGACTGTTGTGGG + Intergenic
957345542 3:78956547-78956569 CACATGCTAGGTGCTGTTTCAGG - Intronic
957606249 3:82403289-82403311 CACACACCAGGTCCTGTTGTGGG + Intergenic
957882431 3:86237276-86237298 CATGTGCCAGGGGCTGTGCTAGG - Intergenic
958739133 3:98047031-98047053 CATATGCCAGGCCCTGTCCTAGG - Intergenic
958782068 3:98554721-98554743 CACTTGCCAGATACTGTTTTAGG + Intronic
959309715 3:104718368-104718390 TATATGCTAGGTGCTGTTTTAGG - Intergenic
959531484 3:107439206-107439228 TACATACCAGGCACTGTTCTAGG + Intergenic
959537595 3:107504214-107504236 CATTTGCCAGGCACTGTTCTTGG - Intergenic
959554630 3:107702594-107702616 AACATGCCAGATGCTTTTTTTGG - Intronic
959621896 3:108407804-108407826 TACATGCCAGGCAATGTTCTAGG + Intronic
959637982 3:108596744-108596766 CGTGTGCCAGGTGCTATTCTAGG + Intronic
960128275 3:114024681-114024703 CACACACCAGGGGCTGTTGTGGG + Intronic
960250061 3:115441836-115441858 CACATTCCAGGTACTGTTCTAGG - Intergenic
960503514 3:118465844-118465866 CATATGCTAGGTACTATTCTAGG - Intergenic
960553337 3:119001381-119001403 TGCGTGCCAGGTTCTGTTCTGGG - Intronic
960603951 3:119485930-119485952 GACATGCTAGGAACTGTTCTTGG - Intronic
960714979 3:120566180-120566202 CAAATGCCAGGCACTGTTCTAGG + Intergenic
961140510 3:124551856-124551878 CACCAGCCAGCTGCTGTGCTGGG - Intronic
961752317 3:129104056-129104078 TACATGCCAGGCACTGTGCTAGG - Intronic
961763776 3:129191998-129192020 CATGTGTCAGGAGCTGTTCTAGG - Intergenic
961814114 3:129539641-129539663 CGTGTGCCAGGTGCTGTGCTGGG + Intergenic
962011822 3:131399312-131399334 TATATGCCAGATGCTGTTTTAGG + Intergenic
962151180 3:132895055-132895077 CACATGCCAGGGCCTGTGGTGGG + Intergenic
962255005 3:133864571-133864593 CACATACCAGGTGAGGTCCTGGG - Exonic
962296875 3:134198388-134198410 TACATGTCAGGTACTGTACTGGG + Intronic
962829258 3:139125569-139125591 TACATGGCAGGCGCTGTGCTAGG - Intronic
962874529 3:139525624-139525646 CAGGTGCCAGGTACTGTGCTGGG + Intronic
962930340 3:140030179-140030201 AATGTGCCAGGTGCTGTCCTGGG + Intronic
963065968 3:141264873-141264895 TATGTGCCAGGTACTGTTCTGGG - Intronic
963488041 3:145961732-145961754 GAAATGCCAGGTGCTGTGATGGG - Intergenic
963679293 3:148353227-148353249 CACATACCAGGGCCTGTTGTGGG + Intergenic
963892645 3:150652930-150652952 CACATGCCAGGCACTGTACATGG - Intergenic
964105265 3:153032553-153032575 TACATGTCAGGTGCTGGTCTTGG - Intergenic
964298438 3:155259951-155259973 CATGTGCCAGATACTGTTCTAGG - Intergenic
964559617 3:157979669-157979691 TACATACCAGGTGCTGTGATAGG + Intergenic
964565879 3:158051949-158051971 CATATGTCAGATGCTGTGCTAGG - Intergenic
964642076 3:158919185-158919207 TATTTGCCAGGTACTGTTCTTGG + Intergenic
964739531 3:159950941-159950963 CATGTGTCAGGTGCTGTGCTAGG + Intergenic
964772293 3:160237240-160237262 CATATGTCAGGCACTGTTCTAGG + Intronic
964832743 3:160903686-160903708 CACATACCAGGCACTGTGCTAGG + Intronic
965385464 3:168040235-168040257 CTTGTGCCAGGAGCTGTTCTAGG + Intronic
965559151 3:170045156-170045178 GAAATGTCAGGTGCTGTTGTGGG + Intronic
965710536 3:171552521-171552543 TACATGCCAGAGACTGTTCTAGG + Intergenic
966158064 3:176939509-176939531 AAAGTGCCAGGCGCTGTTCTAGG - Intergenic
966179797 3:177177778-177177800 AACCTGCTAGGTCCTGTTCTAGG + Intronic
966310116 3:178584524-178584546 CATGTGCCAGGCACTGTTCTAGG - Intronic
966550777 3:181201643-181201665 CACATGGCGGGGGCAGTTCTGGG + Intergenic
966671067 3:182526652-182526674 CATGTGCCAGGTACTGTTCTAGG + Intergenic
967332328 3:188303384-188303406 CCCATGCCAGGTACTACTCTAGG - Intronic
967943823 3:194786775-194786797 TATATGCCAGATGCTGTGCTAGG + Intergenic
968007146 3:195250856-195250878 TATGTGCCAGGTGCTGTCCTGGG - Intronic
968062429 3:195735833-195735855 TATGTGCCAGGTACTGTTCTTGG - Intronic
968081944 3:195852626-195852648 CATGTGCCAGGCGCTGTTTTAGG + Intergenic
968272585 3:197415878-197415900 CACATACCAGGGACTGTTGTGGG + Intergenic
968757531 4:2424605-2424627 AACATGCCAGGTGCTCCTCCTGG + Intronic
968870981 4:3242111-3242133 CACAGGCCAGATGTTGTTCCTGG + Exonic
969042035 4:4306698-4306720 CATGGGCCAGGTGCTGTGCTGGG + Intronic
969065009 4:4472310-4472332 TACATGCCAGGTACTGTGCATGG + Intronic
969146362 4:5127484-5127506 TTCATGTCAGGTGCTGTTTTGGG + Intronic
969146616 4:5129916-5129938 TATATGCCAGGCACTGTTCTAGG + Intronic
969227264 4:5807193-5807215 GGCCTGCCAGGTGCTGTGCTGGG - Intronic
969388723 4:6874778-6874800 GACATGCCAGCCACTGTTCTAGG - Intronic
969444600 4:7237121-7237143 CACATTCCAATTTCTGTTCTCGG - Intronic
969509284 4:7608469-7608491 TACATGCCAGGTGTTGTCCTGGG - Intronic
969860919 4:10034738-10034760 CTAGTGCCAGGTGCTGTTCTAGG - Intronic
970031216 4:11677051-11677073 CACATACCAGGGCCTGTTGTGGG - Intergenic
970454087 4:16204657-16204679 CACTGGCCAGGTGCTGGGCTTGG + Intronic
970612778 4:17741082-17741104 CACGTGCCAGGCACTGTTCTTGG + Intronic
970616106 4:17769808-17769830 CACTTGCCAGGCACTGTTCTAGG + Intronic
970951451 4:21760928-21760950 TACATGGCAGGCACTGTTCTAGG + Intronic
970992036 4:22223748-22223770 CACATTCCAGGCTTTGTTCTAGG - Intergenic
971000150 4:22313067-22313089 TAAATGCCAGGCACTGTTCTTGG - Intergenic
971124536 4:23738751-23738773 AACATGTCAGGTGCTTTTCTTGG - Intergenic
972286115 4:37650130-37650152 CACATGCCAGGCACCATTCTAGG + Intronic
972347236 4:38202776-38202798 CACACACCAGGCACTGTTCTAGG - Intergenic
972383119 4:38537376-38537398 CAAATGCCAGGTACTGTGCTAGG - Intergenic
973298778 4:48556770-48556792 GACAGGCCAGGTGCTCTTCTGGG - Intronic
973545630 4:51978880-51978902 CACATCTCAGCTGCTGTTCTGGG + Intergenic
973568042 4:52207987-52208009 CATCTGCCAGGTGCCCTTCTGGG + Intergenic
973651711 4:53003223-53003245 CATATGGCAGGCACTGTTCTTGG + Intronic
973688125 4:53395682-53395704 TGCATGCCAGGTACTGTTTTAGG + Intronic
974596407 4:64018722-64018744 CACATACCAGGGACTGTTGTGGG - Intergenic
975098243 4:70482067-70482089 CACAAGCCAGATGCAGGTCTGGG + Exonic
975120190 4:70719855-70719877 CACATGCCAGGTAGTGATCCAGG - Intronic
975869266 4:78760180-78760202 CACATACCAGGGCCTGTTTTGGG + Intergenic
975993219 4:80282565-80282587 CACATGCCAGGCACTGTGCTAGG - Intronic
976821184 4:89208865-89208887 CACAAACCAAGAGCTGTTCTTGG - Intergenic
977160706 4:93631375-93631397 CACACACCAGGTCCTGTCCTAGG - Intronic
977191345 4:94004650-94004672 CACACACCAGGGACTGTTCTAGG + Intergenic
977257970 4:94760768-94760790 CACATACCAGGTACTGTGCTGGG - Intronic
977272517 4:94935406-94935428 CACATGCCAGGCACCCTTCTAGG + Intronic
977342196 4:95772810-95772832 CACATGCCAGGGCCTGTTGGGGG - Intergenic
977610819 4:99028344-99028366 CACATGCCAGGCACTCTGCTTGG + Intronic
977705152 4:100062379-100062401 TATATGCCAGGCACTGTTCTAGG + Intergenic
977765737 4:100795826-100795848 CAAGTGCCATCTGCTGTTCTTGG - Intronic
977961570 4:103090946-103090968 CACATGCCAGGCTCCATTCTAGG - Intronic
978399588 4:108316551-108316573 TCCATGCCAGGTGCTACTCTAGG + Intergenic
979316707 4:119273520-119273542 TATATGCCATGTGCTGTTCTAGG - Intronic
979319981 4:119311902-119311924 TATGTGCCAGGTGCTGATCTAGG - Intergenic
979437025 4:120705230-120705252 CACATGCCAGGCACTGTTCTAGG + Intronic
979467192 4:121054369-121054391 TACATGCCAGGTACTCTTCTAGG + Intronic
979532639 4:121785421-121785443 GACATGTCAGTGGCTGTTCTGGG - Intergenic
979650496 4:123124469-123124491 CACATACCAGGGCCTGTTGTGGG + Intronic
979836286 4:125371959-125371981 CAAGTGCCAGGTTCTGTCCTAGG - Intronic
979840384 4:125432121-125432143 CTCCTGCCTGGTGCTCTTCTAGG + Intronic
980091387 4:128446844-128446866 TACATGACAGGTACTTTTCTAGG + Intergenic
981015610 4:139970854-139970876 CATATGCTAGGTGCTCTTCTAGG - Intronic
981625848 4:146753885-146753907 CACACGCCAGGGACTGTTGTGGG + Intronic
981681394 4:147403464-147403486 CACACACCAGGGCCTGTTCTGGG - Intergenic
981769227 4:148288385-148288407 TAAATGCCAGGCACTGTTCTAGG + Intronic
981884130 4:149652277-149652299 CACATGCCAGGGCCTGTTGAGGG + Intergenic
982357362 4:154485594-154485616 TACATGCCAGGAACTGTTCTTGG - Intronic
982358565 4:154494130-154494152 TACATGCTAGGTACTGTTCTAGG - Intergenic
983502809 4:168518859-168518881 TACATGCCAGACACTGTTCTAGG - Intronic
983530677 4:168806982-168807004 CACGTGCCCGGAGCTGTGCTGGG + Intronic
984504690 4:180602286-180602308 CATATGCCAGGTATTGTTTTGGG + Intergenic
984677577 4:182567899-182567921 CATGTGCCAGGCACTGTTCTAGG - Intronic
984838896 4:184050182-184050204 TATATGCCAGGCGCTGGTCTAGG + Intergenic
985169945 4:187138133-187138155 CACATACCAGGGCCTGTTGTGGG + Intergenic
986324975 5:6665560-6665582 CCCAGGCCAGGTGCAGTGCTGGG - Intronic
986451574 5:7869924-7869946 TTCATGCCAGGTGCCGTTCTGGG + Intronic
986724567 5:10584678-10584700 CCTGTGCCAGGCGCTGTTCTAGG + Intronic
986871946 5:12059036-12059058 CACATACCAGGGCCTGTTGTGGG + Intergenic
986957170 5:13166776-13166798 CACATGCCATTTGCTGATCCAGG - Intergenic
987521054 5:18984126-18984148 CTCATGCCAGGCCCTGTGCTGGG - Intergenic
987757755 5:22118924-22118946 CACATGGAAAGTTCTGTTCTGGG + Intronic
987784576 5:22483374-22483396 ACTATGCCAGGAGCTGTTCTAGG + Intronic
987822355 5:22981854-22981876 CACATGCCAAGGGCAGTGCTAGG + Intergenic
987889133 5:23853509-23853531 CACATGCCAGGGCCTGTTGGGGG - Intergenic
988616099 5:32776691-32776713 TATGTGCCAGGTGCTGTTCAAGG + Intronic
988801247 5:34698366-34698388 CAAATGCCAGGCACTGTGCTAGG - Intronic
988987606 5:36636185-36636207 TATATGCCAGGTGCTTCTCTAGG + Intronic
989013403 5:36900632-36900654 CATATGCTGGGTGCTGTGCTTGG - Intronic
989106937 5:37871712-37871734 TACATGCCTGGTGCTATGCTAGG - Intergenic
989118407 5:37978945-37978967 CATGTGTCAGGTACTGTTCTAGG + Intergenic
989272900 5:39553624-39553646 CACATACCAGGGACTGTTGTGGG + Intergenic
989465301 5:41747887-41747909 CACACGCCAGATGCTAATCTAGG - Intronic
989637543 5:43552793-43552815 CATGTGCCAGGTCCTGTGCTAGG - Intronic
990448626 5:55915866-55915888 TACATGCCAGGTGCTGGGCTAGG + Intronic
990552540 5:56898348-56898370 TACATGCCAGATACTATTCTAGG - Intergenic
990636496 5:57733686-57733708 CATATGCCAGGCCCTGTGCTAGG - Intergenic
990724440 5:58737552-58737574 TACATGCCAGGGACTATTCTAGG - Intronic
990736347 5:58867454-58867476 TACAAGCCAGGCACTGTTCTAGG - Intergenic
990840974 5:60078548-60078570 CACACACCAGGGCCTGTTCTGGG - Intronic
990906183 5:60805873-60805895 TACATGCCAGGCGTTGGTCTAGG - Intronic
990967015 5:61459708-61459730 CATATGTCAGGCACTGTTCTAGG + Intronic
991120180 5:63004073-63004095 CACACACCAGGGGCTGTTGTGGG - Intergenic
991238891 5:64433194-64433216 CTCATGCCAGGCACTATTCTTGG + Intergenic
991312926 5:65264799-65264821 TACATGCCAAGTGCTATTCTAGG - Intronic
992472347 5:77070456-77070478 CATAGGCCAGGCACTGTTCTAGG + Intergenic
993090702 5:83422448-83422470 TACATGTTAGGTGCTGTGCTAGG - Intergenic
993636099 5:90345644-90345666 CACATGCCCAGCACTGTTCTGGG - Intergenic
994760533 5:103846919-103846941 CATCTACCAGGTGTTGTTCTAGG + Intergenic
995074076 5:107960814-107960836 TTCATGCCAGGTACTGTGCTGGG + Intronic
995221273 5:109650964-109650986 AACGTGCCAGGTACTGTTTTAGG + Intergenic
995247410 5:109950259-109950281 CACTTGCCAGTCTCTGTTCTAGG + Intergenic
995254365 5:110029335-110029357 CACTTGCCAGGCACTGCTCTCGG + Intergenic
995735731 5:115297415-115297437 CATATGTCAGGCACTGTTCTAGG + Intergenic
995848028 5:116514974-116514996 CACTTTCCAGGTGGTATTCTTGG - Intronic
996219413 5:120911324-120911346 CTCATGCCAGATACTTTTCTAGG - Intergenic
996473146 5:123884093-123884115 TACATGCCAGGCACAGTTCTAGG + Intergenic
996634977 5:125678387-125678409 AACATGCCAGTAGCTGTTTTAGG - Intergenic
996658270 5:125967502-125967524 GAAATGCCAGGGGTTGTTCTAGG + Intergenic
997227388 5:132219354-132219376 CAGATGCCAGGCACTGATCTAGG + Intronic
997235728 5:132271057-132271079 CACATGCAGGGTGCTCATCTGGG - Exonic
998096406 5:139397985-139398007 TATGTGCCAGGTGCTGTTTTAGG - Intronic
998232507 5:140370069-140370091 CACATGCCACGCACTGTTCTAGG + Intronic
998385562 5:141755247-141755269 TCCGTGCCAGGTGCTGTGCTGGG + Intergenic
999137338 5:149331090-149331112 CTCATGCCAAGTGCTGTGTTGGG - Intronic
999326404 5:150646907-150646929 TGTATGACAGGTGCTGTTCTAGG + Intronic
999516026 5:152302347-152302369 TACATGCCAGGTACTGTGCCCGG - Intergenic
999941843 5:156551540-156551562 CATGTGCCAAGTACTGTTCTAGG - Intronic
999953714 5:156677520-156677542 CACATACCAGGGCCTGTTGTAGG + Intronic
1000349412 5:160341485-160341507 TATATGCCAGGCTCTGTTCTGGG - Intronic
1000531275 5:162423211-162423233 CAATTACCAGGTGCTATTCTAGG - Intergenic
1000696578 5:164393206-164393228 CATATGCCAGGCACTGTTTTAGG + Intergenic
1001355344 5:171016913-171016935 CACATGCCAGGGCCTGTTGGGGG - Intronic
1001701455 5:173709601-173709623 CATATGCCAGGCAGTGTTCTAGG - Intergenic
1001875736 5:175198787-175198809 TACATGCCAGGTGGTGTTTTAGG + Intergenic
1002372516 5:178766748-178766770 CATATGCTGGGTGCTGTTCCAGG - Intergenic
1002391675 5:178918199-178918221 ATCAAGCCAGGTACTGTTCTGGG - Intronic
1002616673 5:180460586-180460608 CATACACCAGGTGCTGTTCTAGG - Intergenic
1003051184 6:2782528-2782550 CACAGACCAGGTGCTCCTCTGGG + Intronic
1003366764 6:5482558-5482580 CGAATGCCAGGTGGTGTGCTAGG + Intronic
1003513151 6:6798355-6798377 CATGTGCCAGGTTCTGTGCTTGG + Intergenic
1003635788 6:7830358-7830380 TATGTGCCAGGTGCTGTGCTGGG + Intronic
1003641487 6:7878974-7878996 CACATGCCAGGCTCTGTGCTAGG - Intronic
1003909228 6:10728239-10728261 TACATGTCAAGTGCTGTGCTAGG - Intronic
1004208462 6:13614646-13614668 CACGGGCCAGCTGCTGTTCCAGG + Intronic
1004285442 6:14316796-14316818 CAGGTGCCAGGTCCTGTTCTAGG - Intergenic
1004326434 6:14677764-14677786 AAAATGCCAGGTACTGTTCTAGG - Intergenic
1004403976 6:15314406-15314428 CACATGCCAGGCACTGTTCCAGG - Intronic
1004623374 6:17351359-17351381 TATATGTCAGGTGCTATTCTAGG + Intergenic
1005376507 6:25187807-25187829 CACATGCCAGGTACTGCTCTAGG + Intergenic
1005439466 6:25850314-25850336 CTCATGCCAGTAGCTTTTCTGGG - Intronic
1005484122 6:26283353-26283375 CGTATGCCAGGTACTGTTCATGG - Intergenic
1005704672 6:28439527-28439549 CATATTCCATGTACTGTTCTAGG + Intronic
1005770478 6:29065724-29065746 CACGTGCCAGGGCCTGTTGTGGG - Intronic
1005849581 6:29811605-29811627 CAGATGGGTGGTGCTGTTCTTGG - Intergenic
1005885857 6:30097226-30097248 CACATGCCACAGACTGTTCTAGG + Intergenic
1005900978 6:30215899-30215921 CACACACCAGGGGCTGTTGTGGG - Intergenic
1006411413 6:33876054-33876076 CACATGGCAAGCACTGTTCTAGG - Intergenic
1006640872 6:35489170-35489192 CATATGCCAGGCACTGTTCTGGG + Intronic
1006767161 6:36517182-36517204 CAGATGGCATGTTCTGTTCTGGG + Intronic
1006923236 6:37639789-37639811 TATATGCCAGGCACTGTTCTAGG - Intronic
1007138001 6:39541551-39541573 TAGATGCCAGGCCCTGTTCTAGG + Intronic
1007278653 6:40693852-40693874 CCCATTCCAGGTGCTGTACTAGG - Intergenic
1007382838 6:41501949-41501971 CATATGCCAGACACTGTTCTAGG - Intergenic
1007485210 6:42176124-42176146 CACAATCCAGGCACTGTTCTAGG - Intronic
1007548132 6:42709476-42709498 TACCTGCCAGCTGCTATTCTAGG + Intronic
1007820540 6:44557702-44557724 GACTTGGCTGGTGCTGTTCTAGG + Intergenic
1007856002 6:44858331-44858353 TACATGTCAAGTGCTATTCTAGG + Intronic
1008014660 6:46504845-46504867 CATCTGGCAGGTGCTGTTTTAGG - Intergenic
1008341039 6:50364553-50364575 AACATGCCGTGAGCTGTTCTTGG + Intergenic
1008503204 6:52203643-52203665 CATGTGCCAGATACTGTTCTAGG - Intergenic
1009190423 6:60622916-60622938 CACATACCAAGTGCTGATTTTGG + Intergenic
1009931479 6:70181582-70181604 TACATGCTAGGCACTGTTCTAGG + Intronic
1009988473 6:70811241-70811263 TACATGCCAAGTGCTATTTTTGG + Intronic
1009991778 6:70852196-70852218 TATATGCCAGGCACTGTTCTGGG - Intronic
1010009647 6:71035743-71035765 TATATGTCAGGTGCTGTGCTAGG + Intergenic
1010087052 6:71932959-71932981 TATGTGCAAGGTGCTGTTCTAGG + Intronic
1010225973 6:73489445-73489467 CACATGCCGGGGCCTGTTGTGGG - Intronic
1010292317 6:74151673-74151695 CACATGCCAGATGCTGAAATTGG + Intergenic
1010424728 6:75715232-75715254 CACATGCCAAGTACTGTGTTAGG - Intronic
1010743075 6:79529937-79529959 CACACACCAGGGGCTGTTGTGGG + Intronic
1010952994 6:82058933-82058955 TATATGCCAGGAACTGTTCTAGG + Intergenic
1011014860 6:82743635-82743657 GACATGGCAGCTGCTGTTCTAGG + Intergenic
1011062000 6:83280850-83280872 CATATGGCAGGTTTTGTTCTAGG - Intronic
1011089219 6:83576879-83576901 CATATGCCAGGCACTGTTTTAGG + Intronic
1011089795 6:83584572-83584594 CAAGTGCCAGGCACTGTTCTAGG + Intronic
1011583210 6:88895472-88895494 CACATGTCCGATGCTGTGCTTGG - Intronic
1011953888 6:93001133-93001155 CACATGCCGGGGCCTGTTGTGGG + Intergenic
1012564093 6:100623947-100623969 CACATACCAGGGCCTGTTGTGGG + Intronic
1012954592 6:105555162-105555184 CAAATGCCAGGTGCTGGACTAGG - Intergenic
1013024810 6:106261572-106261594 CTCATTCCAAGTTCTGTTCTGGG - Intronic
1013321705 6:108997547-108997569 CAAATGCTAAGTGCTGTACTTGG + Intronic
1013459643 6:110362949-110362971 TACATGCCAGATACTGTTCTAGG - Intergenic
1013581731 6:111541810-111541832 CACGTGCCAGGCACTGTTCCAGG + Intergenic
1013588054 6:111596944-111596966 TATGTGCCAGGTGCAGTTCTAGG - Intronic
1013629260 6:111969581-111969603 TACGTGCCAGGCACTGTTCTGGG - Intergenic
1013856339 6:114578158-114578180 CACATGCCAAGCACTCTTCTAGG + Intergenic
1013873124 6:114792364-114792386 CAAATGCCAGATGCTGTGCCAGG - Intergenic
1014162507 6:118186289-118186311 CTGATGGCAGGTGCTGTGCTGGG - Intronic
1014182155 6:118396903-118396925 CATGTGCCAGGTGCTGTTTTAGG - Intergenic
1014985940 6:128009648-128009670 CAAATGCCAGGTGGTATGCTTGG + Intronic
1015201863 6:130591952-130591974 GACATGCCAAGTACTGTGCTAGG + Intergenic
1015276657 6:131389296-131389318 CTCATGCCAGGTACTATTCTAGG + Intergenic
1015413214 6:132918068-132918090 GACATACCAGATACTGTTCTAGG - Intergenic
1015678355 6:135776386-135776408 TACGTGCCAGGCACTGTTCTAGG - Intergenic
1015684230 6:135841553-135841575 TACATGCCAGGTACTGTGCTAGG + Intergenic
1015776669 6:136821771-136821793 CAAATGCCTAGTACTGTTCTTGG + Intergenic
1015897765 6:138033750-138033772 CATATACCAGGTATTGTTCTAGG - Intergenic
1016076437 6:139802140-139802162 CATATGCAAGATGCTGTCCTAGG + Intergenic
1016451794 6:144190371-144190393 CATGTGCCAGGCACTGTTCTAGG - Intergenic
1016621735 6:146118601-146118623 CACATGCCAGGGCCTGTTGCAGG - Intronic
1017209645 6:151840897-151840919 TACATGCCAGGTACTGTGCTGGG + Intronic
1017529078 6:155269687-155269709 CATATGCCAGGTACTGTTTAAGG - Intronic
1017703267 6:157096258-157096280 TACTTGCCAGGCACTGTTCTTGG - Intronic
1017708539 6:157146731-157146753 TACATTCCAGAAGCTGTTCTAGG - Intronic
1017733924 6:157343142-157343164 CACACGCCAGGGCCTGTTGTGGG + Intergenic
1017809589 6:157975273-157975295 CAGGTGCCAGGCACTGTTCTAGG + Intergenic
1018039005 6:159905201-159905223 CCCATGCCAGGCACTGTGCTAGG - Intergenic
1018203581 6:161416411-161416433 TACGAGCCAGGTCCTGTTCTAGG - Intronic
1018205031 6:161429258-161429280 GACATGCTAGGTGCTGGGCTAGG + Intronic
1018660407 6:166080915-166080937 CACATGCTGGGAGCTGTTCTGGG - Intergenic
1018722933 6:166587510-166587532 TCTATGCCAGGTACTGTTCTGGG - Intronic
1019130095 6:169867097-169867119 CCCGTGCCAGGTCCTGTGCTGGG + Intergenic
1019359072 7:595473-595495 CACCTGCCAGGCCCTGTTCTGGG - Intronic
1019518125 7:1448493-1448515 CCCATGCCAGGGGCCATTCTTGG + Intronic
1019726070 7:2603352-2603374 CACATGCCAGGCGCCAGTCTAGG - Intronic
1020234102 7:6342100-6342122 CAGGTGCCAGGTGCTGTTCTAGG + Intronic
1021812663 7:24418339-24418361 TATGTGCCAGGTGCTGTCCTGGG + Intergenic
1021897078 7:25247304-25247326 CACATGCTAGGCACTGTTCTTGG + Intergenic
1021937529 7:25646039-25646061 CACGTCCCAGGTGCTGTGCCAGG + Intergenic
1022109756 7:27220986-27221008 TATATGACAGGTGCTGTGCTAGG + Intergenic
1022191011 7:28016839-28016861 TATGTGCCAGGTACTGTTCTAGG + Intronic
1022201246 7:28119764-28119786 TACGTGCCAGATGCTATTCTGGG + Intronic
1022299593 7:29090595-29090617 TATGTGCCAGCTGCTGTTCTTGG - Intronic
1023354954 7:39357319-39357341 CATATGCCAGGCACTGTCCTAGG + Intronic
1023389812 7:39698839-39698861 GACATGCCAGTTGCTGTTTTTGG - Intronic
1023550702 7:41367260-41367282 CATGTGCCAGGCTCTGTTCTAGG + Intergenic
1023869628 7:44256062-44256084 CACATGCCAGGTGCTGGTCGGGG - Intronic
1024098967 7:46009652-46009674 CACAGTCCATGTGCTGTTCATGG + Intergenic
1024475769 7:49808065-49808087 TCCATGACAGGTCCTGTTCTTGG + Intronic
1024548120 7:50539191-50539213 CAAAAGCCAGGGGCTGTCCTTGG - Intronic
1024626398 7:51211464-51211486 CACATGCCTGGCACTGTGCTCGG - Intronic
1024868013 7:53925978-53926000 TGCATGCCAGGTCCTGTTCTGGG - Intergenic
1025020738 7:55477297-55477319 CACATGCAAGGTGCCGTTCTGGG - Intronic
1026362977 7:69619726-69619748 TCTATGCCAGGTTCTGTTCTAGG + Intronic
1026557101 7:71418028-71418050 CATATCCCTGGTGCTGTTCTAGG + Intronic
1027699919 7:81456972-81456994 CACATGCCAGGCTCTGTGCCAGG + Intergenic
1027744414 7:82055744-82055766 CACACACCAGGTCCTGTTGTAGG + Intronic
1027918358 7:84357295-84357317 CACATGCCAGGGCCTGTTGTGGG - Intronic
1028167709 7:87557338-87557360 AACATGCCAGGCACTGTGCTAGG - Intronic
1028204146 7:87996944-87996966 CACATGCCAAGCACTGTTTTGGG - Intronic
1028435959 7:90803951-90803973 CATGTGCCAGGCACTGTTCTAGG - Intronic
1028601687 7:92607733-92607755 CGCCTGTCAGGTGCTGTTCCTGG + Exonic
1028677572 7:93484088-93484110 CACATGTCAGGCACTCTTCTAGG + Intronic
1029468213 7:100739351-100739373 AATATGCCAGGTGCTGTCCTAGG + Intronic
1029940651 7:104477364-104477386 CACATGCCAGGCACTGTGCTTGG + Intronic
1030147505 7:106371472-106371494 CATATGCCAGGCACTATTCTAGG - Intergenic
1030164791 7:106543375-106543397 CAAGGACCAGGTGCTGTTCTAGG + Intergenic
1030333420 7:108297579-108297601 TACATGCCAGGCAGTGTTCTTGG + Intronic
1030569389 7:111203258-111203280 TATATACCAGGTGCTGATCTTGG + Intronic
1030679149 7:112415833-112415855 CACAAGACTGGTGTTGTTCTGGG + Intergenic
1030861668 7:114639368-114639390 CACATGCCACGCACTGTTCAAGG + Intronic
1031103049 7:117506047-117506069 CATATGCCAGGCCCTATTCTAGG - Intronic
1031125826 7:117772389-117772411 CAAATGCCAGGTGATGCTGTTGG + Intronic
1031189160 7:118524676-118524698 CAGATTCCAGATGCTGTTTTAGG + Intergenic
1031257627 7:119475926-119475948 TACATGCCAGGTACTGTTCTCGG - Intergenic
1031666794 7:124494663-124494685 CACACACCAGGGCCTGTTCTGGG - Intergenic
1032676379 7:134133579-134133601 CACATGCCAGCCACTGTGCTTGG - Intronic
1032687973 7:134255179-134255201 CACATGCCAGTTTCCGTTCTGGG + Intronic
1032744430 7:134771529-134771551 CAGGTGACAGGTGCTGTTGTGGG - Intronic
1033276130 7:139972844-139972866 CACGTGCCAGGCACTGTGCTCGG - Intronic
1033375278 7:140755171-140755193 CACATACCAAGCACTGTTCTCGG - Intronic
1034131941 7:148727102-148727124 CATATGCCAGGCACTGTCCTAGG - Intronic
1034736619 7:153434743-153434765 CGCATGCCAGGTCGTGTGCTAGG - Intergenic
1034953915 7:155321496-155321518 TACATTCCAGGAACTGTTCTAGG + Intergenic
1035174923 7:157043759-157043781 CACATCCGAAGTGCTGTTTTGGG - Intergenic
1035600374 8:893753-893775 GCCCTGCCAGGTGCTGTCCTAGG + Intergenic
1035737304 8:1898149-1898171 CAGATTCCAGGGGCTGTCCTTGG - Intronic
1036733968 8:11291286-11291308 TATATGCTAGGTGCTGTACTAGG + Intronic
1037708583 8:21336565-21336587 TACATGCCAGGCACTGTTCTAGG - Intergenic
1038151771 8:24947968-24947990 TAAATGCCAGATGCTGTTCAAGG - Intergenic
1038160546 8:25033109-25033131 CACATGCCAGGTACTATACTGGG + Intergenic
1038330262 8:26602709-26602731 CATCTGGCAGGTGCTGATCTGGG + Intronic
1038532178 8:28327425-28327447 CACATGCCAGGGCCTGTGCTTGG + Intronic
1039204979 8:35141992-35142014 TACATGCCAGATACTATTCTAGG - Intergenic
1039435729 8:37557968-37557990 TACATGCCAGGCACTGTTTTAGG - Intergenic
1039444318 8:37618811-37618833 AACATGTCAGGCACTGTTCTGGG + Intergenic
1039685386 8:39796201-39796223 CACATACCAGGGCCTGTTGTGGG - Intronic
1039890498 8:41682499-41682521 CACATGCCAGGCACTGTGCTAGG - Intronic
1039896272 8:41718929-41718951 CACAGGCCACGTACTGTTATAGG - Intronic
1039993382 8:42509211-42509233 TACATACCAGGTACTGTTCTTGG - Intronic
1040085888 8:43340834-43340856 CACATACCAGGGACTGTTGTGGG + Intergenic
1040445667 8:47490827-47490849 CACATACCAGGGCCTGTGCTAGG + Intronic
1041145315 8:54870132-54870154 CAGATACCAGGGGCTGATCTTGG - Intergenic
1042276143 8:67007243-67007265 CATGTGCCAGGCACTGTTCTAGG - Intronic
1042353409 8:67800793-67800815 TAGATGCCAGGCACTGTTCTAGG + Intergenic
1042679494 8:71366672-71366694 TACATGCCAGGCACTGTGCTAGG + Intergenic
1042777676 8:72451921-72451943 TATATGCCAGATCCTGTTCTAGG - Intergenic
1043011112 8:74883089-74883111 CATATGCCAGGCACTATTCTAGG - Intergenic
1043177529 8:77041805-77041827 CAGATGTCAGCTGCTGTACTTGG + Intergenic
1043200557 8:77364363-77364385 CACACGCCAGGGCCTGTTGTGGG + Intergenic
1043503364 8:80877717-80877739 CAAGTGCCAGGTCTTGTTCTTGG + Intergenic
1043837153 8:85061064-85061086 TACATGCCAGGAACTGTTCTAGG + Intergenic
1043964082 8:86452036-86452058 CACAGGCCATGTGCTGGTGTAGG - Intronic
1044067826 8:87720363-87720385 CACACACCAGGTCCTGTTGTGGG - Intergenic
1044607228 8:94057935-94057957 CACATGCCAGCCACTGCTCTAGG + Intergenic
1044930167 8:97244630-97244652 CACCTGCCAGGTGCTTTGCTGGG - Intergenic
1044963780 8:97556317-97556339 CACGTGCCAAGTGCTGTGCTGGG + Intergenic
1045228007 8:100269923-100269945 CACATGACATGTGCTGTTTGTGG - Exonic
1045415128 8:101958571-101958593 CATATGCCAGAACCTGTTCTAGG + Intronic
1046015952 8:108605455-108605477 CATAGGCCAGATACTGTTCTAGG - Intergenic
1046785359 8:118259999-118260021 CACATGCCAAATGTTATTCTAGG + Intronic
1046789672 8:118307543-118307565 CACATGCCTGGGGCTCTGCTAGG + Intronic
1046791287 8:118324899-118324921 CATGTGCCAGGTACTGTTCTAGG - Intronic
1047062897 8:121248231-121248253 CACATGCCAGGGCCTGTTGGGGG + Intergenic
1047514136 8:125538880-125538902 CACACGCCAGGTCCTGCTCAGGG - Intergenic
1047969968 8:130076222-130076244 TACATGCCAGGTGCTGCTCTAGG + Intronic
1048308724 8:133301724-133301746 TATATGCCAGGGACTGTTCTAGG - Intronic
1048342157 8:133548526-133548548 CACATGCCAAGTGGTGTGCTGGG - Intronic
1048348966 8:133600389-133600411 CAAAAGCCAGGTGCTGTGCTTGG - Intergenic
1048485700 8:134845344-134845366 CATATACCAGGTGCTGTCCCAGG - Intergenic
1048541727 8:135348223-135348245 CACTTGCCAGGCACTGTGCTAGG + Intergenic
1048624492 8:136170259-136170281 CACATACCAGGGACTGTTGTGGG + Intergenic
1048883443 8:138888850-138888872 TACATGCTAGGAGCTGTTCTAGG - Intronic
1048922809 8:139246284-139246306 CATGTGCCAGGCGCTGTCCTTGG - Intergenic
1049030967 8:140037294-140037316 CAAACGCCAGGCACTGTTCTCGG - Intronic
1049061812 8:140282074-140282096 CATTTGCCAGTTGCTGTGCTGGG - Intronic
1049214112 8:141399789-141399811 TACCTGCCAGGTTGTGTTCTTGG + Intronic
1049283355 8:141761719-141761741 CATTTGCCAAGTGCTGTTTTTGG + Intergenic
1049696594 8:143986912-143986934 CACCTGCCAGGTGCTGAGCATGG + Intronic
1049750191 8:144279392-144279414 CACATGGCTGGTGGTGGTCTTGG - Intronic
1050198436 9:3113134-3113156 CACATACCAGGGCCTGTTGTGGG + Intergenic
1050267189 9:3903615-3903637 CATATGCCAGGCACTGTTCTAGG + Intronic
1050381725 9:5037687-5037709 CACATACCGGGGCCTGTTCTGGG + Intronic
1050622015 9:7463667-7463689 GACATGTCAGGTGATTTTCTCGG + Intergenic
1050634931 9:7602310-7602332 CACGTGCCTGGCACTGTTCTAGG - Intergenic
1051085159 9:13340304-13340326 CACACACCAGGTCCTGTTGTGGG - Intergenic
1051091119 9:13409541-13409563 CACACGCCAGGTCCTGTTGGGGG - Intergenic
1051634751 9:19171505-19171527 TATATGCCAGGTGCTATTTTAGG - Intergenic
1052405962 9:28061173-28061195 TAGATGCCAGGTTCTGTGCTAGG - Intronic
1052741482 9:32396801-32396823 TACATGCCAGGAACTGTTTTAGG - Intronic
1053091638 9:35283562-35283584 TACATTCCAGGTTTTGTTCTAGG + Intronic
1053138583 9:35667338-35667360 CATGTGCCAGGTCCTGTGCTAGG + Intronic
1053519956 9:38767275-38767297 CATGTGACAGGTGCTGTTTTAGG + Intergenic
1053704148 9:40732760-40732782 CACACACCAGGTCCTGTTGTGGG - Intergenic
1054414233 9:64856366-64856388 CACACACCAGGTCCTGTTGTGGG - Intergenic
1056089939 9:83195531-83195553 CACATGCCAGGCACTATTCCAGG + Intergenic
1056506624 9:87263928-87263950 CACATACCAGGGCCTGTTGTGGG + Intergenic
1056569636 9:87803930-87803952 TGCATGCCAAGAGCTGTTCTGGG - Intergenic
1056674860 9:88666549-88666571 CATATGCCAGGAGCAATTCTGGG - Intergenic
1056831095 9:89918148-89918170 CCCTGGCCAGGTGCTGCTCTGGG - Intergenic
1056996580 9:91467696-91467718 CACATACCAGGGCCTGTTGTGGG - Intergenic
1057324992 9:94054036-94054058 TATGTGCCAGGTCCTGTTCTAGG + Intronic
1057406125 9:94772453-94772475 CATATGCCAGCCCCTGTTCTTGG + Intronic
1057687707 9:97250697-97250719 TACATCCCAGGCACTGTTCTAGG - Intergenic
1057818951 9:98316552-98316574 CATTTGCCAGATACTGTTCTGGG + Intronic
1057929214 9:99179134-99179156 CATATGCCAGGCTCTGTACTGGG + Intergenic
1058586396 9:106511023-106511045 TATATGCCAGGTACTATTCTAGG - Intergenic
1058652761 9:107192078-107192100 CACATGCCAGGTGCCAAGCTAGG + Intergenic
1058805703 9:108589361-108589383 GATATGTCAGATGCTGTTCTGGG - Intergenic
1058971534 9:110087750-110087772 CATAGGCCAGTTACTGTTCTAGG + Intronic
1059531982 9:115043589-115043611 TGCATGCCAGATGCTGTGCTGGG - Intronic
1059611540 9:115902805-115902827 TACATGCCAGGAACAGTTCTAGG - Intergenic
1059685132 9:116627814-116627836 TACAAGCCAGGCACTGTTCTAGG + Intronic
1059719303 9:116944038-116944060 CATGTGCCAGGTACTGTTCTCGG + Intronic
1059921085 9:119160567-119160589 TACATGCCAGACACTGTTCTAGG + Intronic
1059996085 9:119911227-119911249 TACATGCCAGGCACTATTCTAGG + Intergenic
1060024645 9:120160964-120160986 CACATGCCATGTGCTTCTTTGGG + Intergenic
1060080589 9:120640527-120640549 CACATGCCAGGCACTGTGCTAGG - Intronic
1060382453 9:123189290-123189312 CACATACCAGGGCCTGTTGTGGG + Intronic
1060412393 9:123408414-123408436 GACATGCCAGGGACTGTGCTAGG + Intronic
1060416644 9:123435377-123435399 CACATCCCAAGAGCTGTTCCTGG + Intronic
1060587272 9:124794467-124794489 CACGTGCCAGGCGCTGTGCTAGG - Intronic
1060736427 9:126069254-126069276 TACGTACCAGGTACTGTTCTAGG - Intergenic
1060742000 9:126105115-126105137 CGTGTGCCAGGTGCTGTGCTAGG - Intergenic
1060828420 9:126699422-126699444 CCCATGCCAGGAGCTGGTCTAGG + Exonic
1060925521 9:127452601-127452623 CATGTGCCAGGTACTGTACTAGG + Intronic
1060991502 9:127852283-127852305 CACATGCAAGGTACAGTTTTAGG + Intronic
1061139074 9:128753408-128753430 CACCTGCCAGGTGCTGGTTAAGG - Exonic
1061272504 9:129551224-129551246 AACAGGCCAGGTGCTGTGCGTGG + Intergenic
1061462994 9:130755091-130755113 CATGTGCCAAGTACTGTTCTAGG - Intronic
1061476331 9:130869355-130869377 CTCATGCCAGGAACTGCTCTTGG + Intronic
1061723288 9:132566981-132567003 CAAATGCCAGGTTCTGTGCCAGG + Intronic
1061788507 9:133045525-133045547 CACAGGCCAGGCTCTGTTCTGGG - Intronic
1061902120 9:133678283-133678305 CTCATGCCAGGTGCCCTGCTTGG - Intronic
1061923475 9:133794753-133794775 CACATGCCAGGTGCTGTGCCTGG + Intronic
1061995466 9:134180760-134180782 CACATGCCAGGGTCTCTTCCTGG + Intergenic
1185724171 X:2405943-2405965 CAAATGCTAAGTGCTTTTCTCGG - Intronic
1186530267 X:10288011-10288033 CACATGCCAGGCATTGTTCCAGG - Intergenic
1186546029 X:10450471-10450493 TACATGCCAGGTCCTGTGCCTGG - Intronic
1186776862 X:12873444-12873466 AACATGCCAGGTACTTCTCTAGG - Intronic
1187230465 X:17416707-17416729 TAGATGCCAGGTGCTATGCTGGG - Intronic
1187257025 X:17652998-17653020 CAGATGCCAGGTACTGTGCTGGG - Intronic
1187290849 X:17951805-17951827 CACATGCCAGACACTATTCTAGG - Intergenic
1187542947 X:20216405-20216427 TACATGCTAGGTACTCTTCTAGG + Intronic
1188123977 X:26345036-26345058 CACATGCCAGGCACTGTTTTTGG + Intergenic
1188483605 X:30658820-30658842 CACATGCCAGATGCTGTGTCAGG - Intronic
1188627435 X:32303336-32303358 TAAGTGCTAGGTGCTGTTCTAGG + Intronic
1189074319 X:37900254-37900276 CACAGGCCAGATAGTGTTCTAGG + Intronic
1189119439 X:38378619-38378641 TATGTGCCTGGTGCTGTTCTAGG - Intronic
1190375410 X:49784162-49784184 TACATGCCAAGCGCTGTACTAGG - Intergenic
1190446013 X:50525134-50525156 CATTTTCCAGGCGCTGTTCTAGG + Intergenic
1190914153 X:54797941-54797963 CACATGTCAGGTGCTGCACCAGG - Intronic
1190914573 X:54801293-54801315 TACGTGTCAGGTACTGTTCTAGG - Intergenic
1191932385 X:66388323-66388345 CACACGCCAGGGCCTGTTGTGGG - Intergenic
1192199383 X:69055655-69055677 CACATGCCAAGTACTTCTCTAGG - Intergenic
1192266954 X:69545228-69545250 TACGTGCCAGGTACTATTCTAGG + Intergenic
1192655478 X:72988886-72988908 CATGTGCCAGGTGCTCTTCTAGG + Intergenic
1192760836 X:74094775-74094797 CACACGCCAGGGCCTGTTGTGGG - Intergenic
1192794411 X:74414356-74414378 CACATGATGGGTGCTGTACTAGG + Intergenic
1193003576 X:76590806-76590828 CATATGCCAGGTGCCCCTCTGGG - Intergenic
1193672756 X:84409704-84409726 CACATACCAGGCACTGTTGTGGG + Intronic
1194231436 X:91329936-91329958 TACATACCAGGTGCTGTGTTAGG + Intergenic
1195101276 X:101556380-101556402 CACATGCCAGGGCCTGTTGGGGG - Intergenic
1195651236 X:107287263-107287285 CACCTTCTAGGTGCTGTGCTAGG + Intergenic
1196049282 X:111288273-111288295 TATGTGCCAGGTGCTGTGCTAGG - Intergenic
1196200374 X:112879864-112879886 TACATGCCAGGCACTGTGCTTGG - Intergenic
1196947049 X:120837690-120837712 TACATGGCAGGTACTGTGCTAGG - Intergenic
1197294598 X:124702918-124702940 CACGTGCCAGGCACTGTTCTTGG + Intronic
1197417653 X:126194532-126194554 CACATACCAGGGCCTGTTGTGGG + Intergenic
1197543509 X:127794723-127794745 CACACACCAGGGCCTGTTCTGGG + Intergenic
1197848397 X:130829642-130829664 TACATGCCAGAAACTGTTCTAGG + Intronic
1197968619 X:132092101-132092123 CACATGCCAGATACTATTATAGG - Intronic
1198016818 X:132619935-132619957 TGTATGCCAGGTGCTCTTCTTGG - Intergenic
1198067041 X:133108575-133108597 CACACGCCAGGGCCTGTTGTGGG - Intergenic
1198573110 X:137979388-137979410 TACATGCCAGAGACTGTTCTGGG - Intergenic
1198664025 X:139002171-139002193 CACATGCCAGGGCCTGTTGGGGG + Intronic
1198812415 X:140549153-140549175 CATGTGCCAGGTGCTGTGTTAGG - Intergenic
1199051419 X:143240755-143240777 CACATGCTGGGAGTTGTTCTGGG + Intergenic
1199133633 X:144225148-144225170 CACACGCCAGGGCCTGTTGTGGG - Intergenic
1199378194 X:147137252-147137274 CACATACCAGGGCCTGTTGTGGG + Intergenic
1199519524 X:148719844-148719866 TACATGCCAGGAGCTCTGCTGGG - Intronic
1199813662 X:151376733-151376755 CCCATGCCATATGCTGTTTTGGG - Intergenic
1200056479 X:153464007-153464029 CACATGCGAGGCGCTGTTCCTGG - Intronic
1200272349 X:154697857-154697879 CAGATACCAAGTGCTTTTCTAGG - Intronic
1200305681 X:155023985-155024007 TATATGCCAGGAACTGTTCTAGG + Intronic
1200886100 Y:8272042-8272064 CAATTGCCAGGTGGTGTTATAGG + Intergenic
1201305679 Y:12548370-12548392 CACATACCAGGGTCTGTTGTGGG - Intergenic
1201447806 Y:14077502-14077524 TACATGCCAAGTGCTATGCTTGG + Intergenic
1201800524 Y:17950029-17950051 CACACTCCAGGGACTGTTCTGGG + Intergenic
1201801029 Y:17955927-17955949 CACACTCCAGGGACTGTTCTGGG - Intergenic
1202082725 Y:21101153-21101175 CTAATGCCAGGGGCTGATCTAGG + Intergenic