ID: 1172744771

View in Genome Browser
Species Human (GRCh38)
Location 20:37198131-37198153
Sequence CACTTCCCGGATCACCTGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 90}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172744771_1172744776 5 Left 1172744771 20:37198131-37198153 CCAGACAGGTGATCCGGGAAGTG 0: 1
1: 0
2: 0
3: 3
4: 90
Right 1172744776 20:37198159-37198181 CTTCTTTCCTTTCTAAGGTTCGG 0: 1
1: 0
2: 3
3: 33
4: 370
1172744771_1172744779 26 Left 1172744771 20:37198131-37198153 CCAGACAGGTGATCCGGGAAGTG 0: 1
1: 0
2: 0
3: 3
4: 90
Right 1172744779 20:37198180-37198202 GGAAGGACTCAAGCGCCTTCAGG 0: 1
1: 0
2: 0
3: 9
4: 67
1172744771_1172744777 9 Left 1172744771 20:37198131-37198153 CCAGACAGGTGATCCGGGAAGTG 0: 1
1: 0
2: 0
3: 3
4: 90
Right 1172744777 20:37198163-37198185 TTTCCTTTCTAAGGTTCGGAAGG 0: 1
1: 0
2: 0
3: 10
4: 108
1172744771_1172744774 0 Left 1172744771 20:37198131-37198153 CCAGACAGGTGATCCGGGAAGTG 0: 1
1: 0
2: 0
3: 3
4: 90
Right 1172744774 20:37198154-37198176 GTTTCCTTCTTTCCTTTCTAAGG 0: 1
1: 1
2: 4
3: 78
4: 771

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172744771 Original CRISPR CACTTCCCGGATCACCTGTC TGG (reversed) Intronic
900459807 1:2797488-2797510 CACCTCAGGGCTCACCTGTCTGG + Intronic
901665557 1:10824275-10824297 CACTTCCAGCATCAGCTCTCTGG - Intergenic
902279126 1:15361615-15361637 TTCATCCTGGATCACCTGTCAGG - Intronic
905297951 1:36966286-36966308 CACTTGCCTGATAGCCTGTCTGG - Intronic
916891173 1:169113895-169113917 CCCTTCCCCCATCACCTTTCAGG + Intronic
918313635 1:183304686-183304708 CACTTCCCAGAGCCCCTGGCAGG + Intronic
920207213 1:204301275-204301297 CACTTGCCTCATCACCAGTCTGG + Intronic
922790337 1:228307647-228307669 CACCTCCCGGTGTACCTGTCAGG + Intronic
1063519743 10:6730479-6730501 CATCTCCCGCATCACCAGTCAGG - Intergenic
1075774834 10:124976071-124976093 AACTTCCTGGATGACCTGACTGG + Intronic
1078060355 11:8039204-8039226 AGCCTCCCTGATCACCTGTCTGG - Intronic
1079913102 11:26335060-26335082 CATTTCCCAGATAACCAGTCTGG - Intronic
1082871258 11:57945271-57945293 CACATCCCTGACAACCTGTCTGG - Intergenic
1083986755 11:66220656-66220678 CACTTCCCGGATCTGCTCGCGGG - Exonic
1084456610 11:69271411-69271433 CACCTCCCCGATCACATGGCAGG + Intergenic
1085865118 11:80281961-80281983 CACTTTGGGGTTCACCTGTCTGG - Intergenic
1086435851 11:86780573-86780595 CATTGCCGGGATCATCTGTCTGG + Intergenic
1086662497 11:89437508-89437530 CACTTCCCAGGTCATCAGTCTGG - Intronic
1089195564 11:116692376-116692398 CCCTTCCCTGATCTCCTGCCAGG + Intergenic
1089457089 11:118632046-118632068 GACTTCACGGCTCACCTCTCGGG - Exonic
1091865970 12:3837201-3837223 CACTGCCAGGATAACCTCTCTGG + Intronic
1096626667 12:52900051-52900073 CAGCTCCCGGATCTCCTGTGGGG + Exonic
1104959672 12:132482642-132482664 TACTTCCCGGATGAAATGTCTGG + Intergenic
1107231002 13:38110506-38110528 CAGTTCACCGATCACCTGTCAGG + Intergenic
1113047064 13:106167786-106167808 CTCTTCCCAGAACACCTGTGTGG + Intergenic
1113458580 13:110466055-110466077 CACTTCCCAGAGTACCTGGCTGG - Exonic
1121245475 14:92458556-92458578 CCCTTCCCAGATTACCTGTTTGG + Intronic
1121275634 14:92665899-92665921 AGCTGCCCGGATCACCTGCCAGG - Intronic
1125760652 15:42093660-42093682 CTCTTCCAGGAGCACCAGTCTGG + Intronic
1129194158 15:73954327-73954349 CGCTTCCTGGCTGACCTGTCAGG + Intergenic
1134333424 16:13271203-13271225 CAGTTCCCGGATCACCAGTGTGG - Intergenic
1136221713 16:28833594-28833616 CACTTCCAGGACCACTTGCCTGG + Intronic
1136334604 16:29603208-29603230 CACTTGCCCCCTCACCTGTCAGG + Intergenic
1138124033 16:54424153-54424175 GACTTCACGGAGCACCTTTCAGG - Intergenic
1141485973 16:84340623-84340645 CACTTCTCTGAACCCCTGTCTGG + Intergenic
1142421427 16:89972758-89972780 CGCCTCCCCGCTCACCTGTCGGG - Intergenic
1143019886 17:3911825-3911847 CCCTTCCAGGCTCTCCTGTCGGG - Intronic
1143028678 17:3955290-3955312 CTCTCCCCGGACCACCTGTTTGG + Intronic
1147425128 17:40342568-40342590 CCCTGCCCGGGTCACCAGTCGGG + Intronic
1147591890 17:41689123-41689145 AACTTCCCGGAACACGTCTCCGG - Intronic
1148400627 17:47356982-47357004 CACTTCCCTGGCGACCTGTCAGG - Intronic
1148565817 17:48632339-48632361 CACTTCCCAGATCTCTTCTCTGG + Intronic
1158039257 18:53072505-53072527 CACTTCCCTGCTCAGCAGTCAGG - Intronic
1158512760 18:58106189-58106211 CACTGCCCAAATCAACTGTCAGG + Intronic
1165452974 19:35895965-35895987 CACATCCCCGCTCACCTGGCTGG + Exonic
1166651981 19:44581653-44581675 CACTTCCTGTCCCACCTGTCTGG + Intergenic
930873965 2:56193146-56193168 CACTTCCAGAAGCACCGGTCAGG + Exonic
936007915 2:108906718-108906740 CCCATCCCGGATCACGTGGCTGG + Intronic
939728694 2:145754827-145754849 CACTTCCAGCATCACCTGCAGGG + Intergenic
942979390 2:182061168-182061190 CACTTCCCTGGTCCCCTTTCTGG + Intronic
944166644 2:196729409-196729431 CACTTCCTGGATACCCTGTGAGG + Intronic
1172329491 20:34065285-34065307 CTCTTCCCTGATTACCTTTCAGG - Intronic
1172744771 20:37198131-37198153 CACTTCCCGGATCACCTGTCTGG - Intronic
1172774110 20:37397365-37397387 CACTTCCCTAATCACCTCCCAGG - Intronic
1174046351 20:47736688-47736710 CCCGTCCCTGCTCACCTGTCCGG + Exonic
1175026523 20:55908336-55908358 TACTTCCCAGATCTCCTGTCTGG - Intergenic
1176254850 20:64146564-64146586 CACTCCCCGCAGCAGCTGTCAGG - Intergenic
1179535236 21:42047122-42047144 CACCTGCCAGATCACCTGCCAGG - Intergenic
1180177486 21:46097815-46097837 CATTTCCCGGACGACCTGGCTGG - Intergenic
1182073717 22:27480585-27480607 TCCTCCCAGGATCACCTGTCAGG - Intergenic
952082856 3:29781872-29781894 CACTTCCCTGGTGACCTGTATGG + Intronic
957040089 3:75329752-75329774 CCCTTCCAGGCTCTCCTGTCTGG + Intergenic
961081785 3:124033806-124033828 CCCTGCCCGGCTTACCTGTCCGG - Intergenic
965000514 3:162947042-162947064 AACTTTCCTGATGACCTGTCAGG + Intergenic
965430341 3:168579165-168579187 CACTTTCCTAATCAGCTGTCAGG - Intergenic
968624021 4:1618478-1618500 CCCATCCCTGCTCACCTGTCTGG - Intronic
968715611 4:2157020-2157042 GCCTTCCCTGATCACGTGTCAGG - Intronic
982049847 4:151489703-151489725 CGCTTCCCTGATGACCTGTAGGG + Intronic
985060074 4:186069185-186069207 CACTTCCCTGATGAAATGTCTGG + Exonic
985315330 4:188653268-188653290 CACTTACAGGTTCACCAGTCAGG + Intergenic
987323071 5:16788156-16788178 CCCTTCCCGCATCACCTTTTTGG - Intronic
997370252 5:133355109-133355131 CAATTCCAGTAGCACCTGTCAGG - Intronic
1001905854 5:175472479-175472501 ACCTTCCCTGGTCACCTGTCTGG - Intergenic
1013370692 6:109468436-109468458 AACTTCCCGGATCTCATCTCAGG + Intronic
1020373683 7:7461620-7461642 CACTTCCCTGACAACCTGTATGG + Intronic
1022682647 7:32564729-32564751 CACTTCCTGAATCAGCTCTCAGG - Intronic
1024788826 7:52939391-52939413 CTTTTCCCGGTTCACCTTTCTGG + Intergenic
1029708899 7:102289029-102289051 CTCTTCCCTGCTCACCTGGCTGG + Intronic
1032017340 7:128388534-128388556 CACTTCCCCCTTCACCTTTCAGG - Intergenic
1032153873 7:129452712-129452734 CACTTCCTGGATGCCCTGTATGG - Intronic
1033501519 7:141955097-141955119 CACTTCCAGGTTCTCCTGTGTGG - Intronic
1037866753 8:22450247-22450269 CACTTTCCACATCAACTGTCTGG - Intronic
1042347849 8:67746208-67746230 CCCTTCCCGGAGAACCTGTGCGG - Exonic
1046274072 8:111933619-111933641 CAGTTGCCAGATCACCTGCCAGG - Intergenic
1049532619 8:143162000-143162022 CACTTCCCAGAGTACCTCTCTGG - Intergenic
1049591533 8:143465061-143465083 CACTCACAGGCTCACCTGTCTGG - Intronic
1062316677 9:135970702-135970724 CCCTTCCCCCATCACCTGGCAGG + Intergenic
1062361560 9:136190690-136190712 CAGTTCCCTGCCCACCTGTCTGG + Intergenic
1062476867 9:136732615-136732637 GACTTCACGGATCACCATTCTGG + Intergenic
1187271953 X:17787912-17787934 CACTTCCCGGACCTCCTCCCGGG + Intergenic
1187959952 X:24558978-24559000 CCCTTCCCTCTTCACCTGTCAGG + Intronic
1188094372 X:26003545-26003567 AACTTTCCTGCTCACCTGTCAGG + Intergenic
1199775710 X:151009642-151009664 CACTGCCAGGCTCACCTTTCAGG - Intergenic
1199875843 X:151927315-151927337 CACATGCCTGAACACCTGTCGGG - Intergenic