ID: 1172747598

View in Genome Browser
Species Human (GRCh38)
Location 20:37224727-37224749
Sequence CTACCCTAGTTGAGTAAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 53
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 49}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172747598_1172747600 1 Left 1172747598 20:37224727-37224749 CCAACTTTACTCAACTAGGGTAG 0: 1
1: 0
2: 1
3: 2
4: 49
Right 1172747600 20:37224751-37224773 TATAGAGGCCAGAAGACAGTAGG 0: 2
1: 4
2: 30
3: 377
4: 4250
1172747598_1172747605 29 Left 1172747598 20:37224727-37224749 CCAACTTTACTCAACTAGGGTAG 0: 1
1: 0
2: 1
3: 2
4: 49
Right 1172747605 20:37224779-37224801 CCATCAAGGCTCTTTGAAGATGG 0: 1
1: 0
2: 2
3: 10
4: 172
1172747598_1172747603 15 Left 1172747598 20:37224727-37224749 CCAACTTTACTCAACTAGGGTAG 0: 1
1: 0
2: 1
3: 2
4: 49
Right 1172747603 20:37224765-37224787 GACAGTAGGGTGAACCATCAAGG 0: 1
1: 0
2: 0
3: 11
4: 372
1172747598_1172747601 2 Left 1172747598 20:37224727-37224749 CCAACTTTACTCAACTAGGGTAG 0: 1
1: 0
2: 1
3: 2
4: 49
Right 1172747601 20:37224752-37224774 ATAGAGGCCAGAAGACAGTAGGG 0: 1
1: 1
2: 5
3: 69
4: 980
1172747598_1172747606 30 Left 1172747598 20:37224727-37224749 CCAACTTTACTCAACTAGGGTAG 0: 1
1: 0
2: 1
3: 2
4: 49
Right 1172747606 20:37224780-37224802 CATCAAGGCTCTTTGAAGATGGG 0: 1
1: 0
2: 1
3: 11
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172747598 Original CRISPR CTACCCTAGTTGAGTAAAGT TGG (reversed) Intronic
903740477 1:25555870-25555892 CCACTCTAGTTGGGTATAGTCGG + Intronic
905744795 1:40405936-40405958 CTTCAGTAGTTGAGTAAAGTAGG + Intronic
910911841 1:92243183-92243205 ATACACTAATTGAGTAAACTTGG - Intronic
913325189 1:117621955-117621977 CTACCCGAGGAGAATAAAGTTGG - Intronic
1068527507 10:58147308-58147330 CCTCACCAGTTGAGTAAAGTAGG - Intergenic
1069211568 10:65767743-65767765 TTACCCCAGTTGAGTATACTAGG - Intergenic
1071193491 10:83129616-83129638 CTATCCAAGTTGAGTAAGTTGGG + Intergenic
1078649473 11:13174850-13174872 CTACCTGAGGTGAGTAGAGTGGG + Intergenic
1082880125 11:58029028-58029050 ATACCCTAGTTGTGTAACTTGGG - Intronic
1087095049 11:94309953-94309975 CTACCCCAGGTGAGTTAACTTGG - Intergenic
1091600183 12:1913250-1913272 TCACCCTAGTTGAGTAAACCAGG - Intronic
1101105017 12:101432201-101432223 CAACCCTGGTTGAGGAAAATAGG - Intergenic
1107334155 13:39335297-39335319 ATGCCCTAGTTGTGTAAACTTGG - Intergenic
1111009780 13:82296238-82296260 CTATCTTATTTGAGTAGAGTTGG - Intergenic
1113033409 13:106019902-106019924 TTACCCTAGTTGAGTAGCTTAGG + Intergenic
1120292474 14:82592625-82592647 CTACCTTAGATGAGTATTGTGGG - Intergenic
1126723021 15:51602173-51602195 CTAACTTAGTTCAGTAAAATGGG - Intronic
1127632078 15:60836844-60836866 CTAACCTAGGAGAGTAAAGGTGG - Intronic
1131406930 15:92172694-92172716 GTACCATAGTTGCATAAAGTAGG - Intergenic
1131848515 15:96513455-96513477 CTACCCAAGTTGAGCCAAGCAGG - Intergenic
1143987531 17:10927827-10927849 GGATCCTAGTTGAGTAATGTAGG + Intergenic
1155125516 18:22871769-22871791 TGACCCTATTTGAGTATAGTTGG - Intronic
1155728803 18:29126062-29126084 CTACCCTAGCTGAGTATCATTGG - Intergenic
928648149 2:33376813-33376835 CTTCCCCAGTTTAGTAAAGGAGG - Intronic
942492596 2:176504970-176504992 TGAACCTAGTTGACTAAAGTGGG + Intergenic
1172747598 20:37224727-37224749 CTACCCTAGTTGAGTAAAGTTGG - Intronic
1177092466 21:16785969-16785991 CACCTCTAGTTGAATAAAGTTGG - Intergenic
1181563338 22:23718188-23718210 CTTCCCTACTGGAGTAAAGTGGG - Intergenic
950371220 3:12532259-12532281 CTAGCCTAGTGGAGATAAGTGGG - Intronic
954238860 3:49277636-49277658 CTACCCTAGATGAATTAAGACGG - Exonic
956542432 3:70356390-70356412 ATACCTAAGTTGATTAAAGTTGG - Intergenic
956616897 3:71181481-71181503 CTACACTCGATGAGTGAAGTTGG - Intronic
956899017 3:73694290-73694312 CTACCCTAGAGGAATAAAGGAGG - Intergenic
967769879 3:193322990-193323012 CTAGCCTAATTGAGTTAACTAGG + Intronic
989755625 5:44949601-44949623 CTACTCTTGTTGAGTGTAGTTGG + Intergenic
1001417298 5:171555122-171555144 CTACTCGAGATGAGTAAGGTGGG - Intergenic
1003134809 6:3426817-3426839 CTACTATAGTTGAGTAACTTTGG - Intronic
1014205133 6:118649321-118649343 CTACCCTAATTGAAGAAATTTGG - Intronic
1025929600 7:65983052-65983074 CTTCCCTACTGGAGTAAACTGGG - Intergenic
1027593102 7:80138977-80138999 TTCCCCTAGTTGAGAAATGTTGG + Intronic
1032465991 7:132145393-132145415 CCACCCTACTTGGGTAAAATTGG + Intronic
1033211627 7:139464167-139464189 CTACCCTTGTGGATTAAGGTGGG - Intronic
1040847980 8:51865111-51865133 CTACCCAAGTTGAATCAAGAAGG + Intronic
1041528740 8:58838513-58838535 CAAAGCTAGGTGAGTAAAGTTGG - Intronic
1045063908 8:98428832-98428854 CTGCCCAAGTTGGCTAAAGTAGG - Exonic
1047869161 8:129063232-129063254 CTTCCAAAGTTAAGTAAAGTGGG - Intergenic
1051940432 9:22499452-22499474 TTACCCTAGGTGAGTAAAGTGGG + Intergenic
1056492595 9:87122169-87122191 CACCCCTAGTTGTGTAAAGGGGG - Intergenic
1061367000 9:130177312-130177334 CCACCCTGGTTGAGCAGAGTTGG - Intronic
1192553881 X:72074678-72074700 CTACCATATTTCAGTGAAGTTGG - Intergenic
1193969026 X:88027568-88027590 TTAATCTAGTTGAATAAAGTTGG - Intergenic
1196160067 X:112473641-112473663 CTACCCTGGTTGAGAAGAGGAGG + Intergenic
1196940520 X:120771414-120771436 CTTCCCTGGTTGAGACAAGTAGG + Intergenic