ID: 1172747622

View in Genome Browser
Species Human (GRCh38)
Location 20:37225029-37225051
Sequence ATGGTTACAGAGCTCAGACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 142}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172747622_1172747626 -3 Left 1172747622 20:37225029-37225051 CCAGGTCTGAGCTCTGTAACCAT 0: 1
1: 0
2: 1
3: 22
4: 142
Right 1172747626 20:37225049-37225071 CATTTGGCTGGTTTATCCCCTGG 0: 1
1: 0
2: 0
3: 9
4: 96
1172747622_1172747631 20 Left 1172747622 20:37225029-37225051 CCAGGTCTGAGCTCTGTAACCAT 0: 1
1: 0
2: 1
3: 22
4: 142
Right 1172747631 20:37225072-37225094 CCATCTTACCCTAAAATCCCAGG 0: 1
1: 0
2: 0
3: 8
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172747622 Original CRISPR ATGGTTACAGAGCTCAGACC TGG (reversed) Intronic
902747804 1:18484824-18484846 CTGGTGCCAGAGCCCAGACCAGG - Exonic
903516068 1:23911837-23911859 GTGGTTACAGAGCTGGGGCCAGG + Intronic
903789894 1:25885729-25885751 ATGGTGAGAGAGATCAGACCAGG + Exonic
905407035 1:37740795-37740817 ATGGTTCCAGGGCTCAGAAAAGG + Intronic
906717859 1:47983720-47983742 GTGGTTACTGAGCTCAGAAAGGG - Intronic
907924795 1:58945043-58945065 AGGGTTATGGTGCTCAGACCAGG + Intergenic
908764222 1:67539814-67539836 AGGGCCACAGAGCTCAGAGCCGG + Intergenic
910378004 1:86594477-86594499 ATGGTTTCAGGGGACAGACCAGG - Intergenic
911071390 1:93834557-93834579 AAGGCTACAGAGCGCAGTCCTGG - Intronic
911121057 1:94297023-94297045 ATGGTCACACAAATCAGACCTGG - Intergenic
913117744 1:115712410-115712432 ATGGTTACAGAGCCCAGACTCGG + Intronic
913240747 1:116827227-116827249 GTGATTGCAGAGCTCAGACATGG - Intergenic
916255758 1:162786601-162786623 AAGGTTACAAAGCCCAGAACTGG - Exonic
917970432 1:180202531-180202553 ATGGTTACAGAGTTCTGCCCTGG + Exonic
922378557 1:224996638-224996660 TTGATTACAGAGCTCAGTCGGGG - Intronic
922430350 1:225546229-225546251 AAGTTTACAGACCTCAGGCCAGG - Intronic
1063710891 10:8476974-8476996 AAGTTTACACAGCTCAGAGCTGG - Intergenic
1065112614 10:22454682-22454704 CTGGTTACATAGCTAAAACCAGG + Intergenic
1066196860 10:33108713-33108735 AAAGTTACACAGCTCAGACATGG + Intergenic
1066439262 10:35422412-35422434 GAGGTTACAGAGCTTAGACAAGG - Intronic
1066722221 10:38352267-38352289 AAGGTTACAAAGCCCAGAACTGG - Intergenic
1068745214 10:60522518-60522540 ATGGGTACAGATCTAAAACCTGG - Intronic
1070646969 10:78208606-78208628 ATGGTTTCAGGGTTCAGAGCTGG + Intergenic
1071260562 10:83915487-83915509 ATGCTTCCAGAGCTCAGAAGGGG + Intergenic
1072567087 10:96625722-96625744 ATAGTTCCAGAGCACAGATCTGG + Intronic
1072849264 10:98870307-98870329 ATGGCTACAGAGATCTGAGCTGG + Intronic
1073212032 10:101812069-101812091 TTGGTTACAGAGCCCAGCCAAGG - Intronic
1073344309 10:102770772-102770794 AGGGTTCCAGAGCGCTGACCAGG + Intronic
1074283686 10:112078167-112078189 ATCATTACAGAGGTCAGACTTGG + Intergenic
1075283181 10:121158969-121158991 ATGGTTGCAGAGCTGAGTCCAGG - Intergenic
1075998845 10:126899298-126899320 ATGGTAGCAGAGCTTAGCCCAGG - Intergenic
1077921514 11:6645316-6645338 ATGGTTCCAGGGCCCAGATCAGG + Intronic
1077939410 11:6824651-6824673 GTGATAACAGAGCTCAGCCCAGG + Intergenic
1079448874 11:20581899-20581921 ATTGTTTCAGAGCTGGGACCAGG + Intergenic
1081759826 11:45569431-45569453 AAAGTGACAGAGGTCAGACCCGG - Intergenic
1082777734 11:57260449-57260471 AAAATTACAAAGCTCAGACCTGG + Intergenic
1082954712 11:58857520-58857542 ATGCTTGCAGAGCCCAGAGCGGG + Intronic
1084085277 11:66852247-66852269 GAGGTTGCAGAGCTGAGACCAGG - Intronic
1084735584 11:71103245-71103267 TTGATTACAGAGCTGAGGCCTGG + Intronic
1085415076 11:76314258-76314280 ATGGCCACAGAGCACAGACCGGG + Intergenic
1085570455 11:77553820-77553842 AAGGCTACAGGGCTCAGTCCTGG - Intronic
1090549555 11:127805356-127805378 ATGGCTGCAGCGCTGAGACCAGG + Intergenic
1096072325 12:48782314-48782336 ATGGTGACAGAGTTCAGGCTTGG + Intronic
1097279136 12:57833697-57833719 ATGTCTACAGAGCTAGGACCTGG + Intronic
1100079445 12:90830049-90830071 ATGGTCACAAAACTCAGTCCTGG + Intergenic
1100484900 12:95015710-95015732 ATGGTAACAGAGCTCCCACGTGG + Intergenic
1104932778 12:132348571-132348593 AAGGAGACAGAGCTCTGACCAGG - Intergenic
1107761960 13:43688989-43689011 ATGATGACAGAACTCAGGCCAGG + Intronic
1107814699 13:44233884-44233906 ATGGGTGCAGAGTTCAGATCTGG - Intergenic
1109388480 13:61664832-61664854 CTGGTAACACAGCTCAGCCCAGG + Intergenic
1110094696 13:71502480-71502502 ATGGTTAAACAGCTCCGACAAGG - Intronic
1111503205 13:89152500-89152522 ATGGTTACAGAATTCAGGTCTGG - Intergenic
1114823877 14:26053795-26053817 ATGGTTTCAGAGGTCAGGGCTGG + Intergenic
1116950573 14:50875007-50875029 ATATTTACTGAGCTCAGCCCTGG + Intronic
1119318642 14:73716334-73716356 AAGCTTACAGAGACCAGACCAGG - Exonic
1119656972 14:76424218-76424240 GTTGTTACAGAGATCAGAACAGG + Intronic
1124892229 15:33743974-33743996 ATGGTAGCAGAGGTCAGATCAGG - Intronic
1126413398 15:48394696-48394718 AAGGTCACACAGCTAAGACCTGG - Intergenic
1129258033 15:74345272-74345294 ATGGTCACAGACCCCAGGCCTGG + Intronic
1132074962 15:98812300-98812322 ATGGTGACACAGCTCACAGCTGG - Intronic
1133035135 16:3030200-3030222 CTGGTGCCAGAGCTCAGGCCAGG - Intronic
1134208175 16:12254293-12254315 AGGGCCACAGAGCTCAGTCCTGG - Intronic
1134326442 16:13212115-13212137 ATGATTACAGAGCACAGATCCGG - Intronic
1134820735 16:17244867-17244889 AAGGAAACAGACCTCAGACCTGG + Intronic
1134836974 16:17369472-17369494 ATGCTTTCAGGGCTCAGCCCAGG - Intronic
1135731020 16:24895186-24895208 ATGGTTACAGAAAACAGACCCGG + Intronic
1136615550 16:31396130-31396152 ATGGTGACAGAAGTCTGACCAGG - Intronic
1139593099 16:67943967-67943989 GTGGTTACTGAGCTCAGCCTTGG + Exonic
1140209491 16:72959506-72959528 ATGGTTTGAGGGCCCAGACCAGG - Exonic
1141381155 16:83578325-83578347 AAGGTTCCAGGGCACAGACCGGG + Intronic
1141440730 16:84028143-84028165 ATGGCTACAAAGCTGAGATCCGG + Intronic
1141939831 16:87267799-87267821 AGGGTTACACAGCTCAGAAGTGG - Intronic
1146403367 17:32517887-32517909 AGGGTCACAGAGCTCAGAGGAGG + Intronic
1151656879 17:75500308-75500330 ATGGTTACAGAGCCAGGGCCTGG + Exonic
1153832793 18:8938017-8938039 ATGATTACATAGCTCAGGCAGGG - Intergenic
1156384688 18:36594489-36594511 ATGGCTCCAGAACTCACACCTGG - Intronic
1161569469 19:5022622-5022644 ATGGTCACAGAGCTAACTCCCGG - Intronic
1161845762 19:6711063-6711085 CTACGTACAGAGCTCAGACCCGG - Exonic
1164876565 19:31694727-31694749 ACGGTTTCAGAGCTCAGAAGTGG + Intergenic
927391374 2:22599249-22599271 GTGGATACAGAGCTCAGAGCAGG + Intergenic
929933792 2:46278367-46278389 AAGGACACAGAGCTCAGACATGG - Intergenic
939511299 2:143109334-143109356 ACGGTTGCAGAGCCCAGAGCAGG + Intronic
939806787 2:146783811-146783833 CTGGTTACAGCACTCAGTCCTGG - Intergenic
942502377 2:176605116-176605138 GTGGTTACAGAGGGCAGACCAGG + Intergenic
946324836 2:218980024-218980046 AGGCTTCCAGAGGTCAGACCTGG + Intergenic
947197458 2:227583250-227583272 ATGGTTTCAGGGGTCAGTCCTGG + Intergenic
947767149 2:232645155-232645177 TTGGTTTTGGAGCTCAGACCTGG + Intronic
947858114 2:233338251-233338273 ATGGCCACAGAGCTCAGAGAAGG + Intronic
948128841 2:235585306-235585328 AGGGATACAGAGCTAAGGCCAGG - Intronic
1169034100 20:2435705-2435727 CTGGTGTCAGAGCTCAGTCCTGG - Intergenic
1169748271 20:8964930-8964952 AAGCATACAAAGCTCAGACCTGG + Intronic
1170058994 20:12239772-12239794 ATGCTCACAGAGCTCAGAGTAGG + Intergenic
1172747622 20:37225029-37225051 ATGGTTACAGAGCTCAGACCTGG - Intronic
1174168917 20:48604326-48604348 ATGGTGGCAGAGCACAGCCCTGG - Intergenic
1175793296 20:61756177-61756199 GTGGTGCCAGAGCTCAGAGCAGG + Intronic
1177064969 21:16419254-16419276 GTGGGTGCAGAGCTCAGAGCCGG + Intergenic
1180746353 22:18091732-18091754 GGGGTCACAGAGCACAGACCTGG + Exonic
1181525723 22:23484796-23484818 ATGGTCACATAGCTCAGGGCAGG - Intergenic
1181850099 22:25743729-25743751 AAGGTTACAGAGCCCACACCAGG - Intronic
1184384688 22:44167415-44167437 AAGTTCTCAGAGCTCAGACCTGG + Intronic
949288678 3:2437663-2437685 ATGGCTTCAGAGCCCAGGCCAGG - Intronic
949505906 3:4727357-4727379 CTGGTTACAGTGCTCTGATCAGG - Intronic
950216261 3:11161908-11161930 ATTGGTACAGAGCTCAGGCTGGG - Intronic
950467623 3:13164457-13164479 ATGGTTCCAGAACTCTGACCTGG + Intergenic
952323068 3:32296087-32296109 ATTGTTACTGAGCACAGAGCTGG - Intronic
954450960 3:50571542-50571564 AAGGTTACACAGCTAACACCAGG - Intronic
956783108 3:72620011-72620033 AAGATTACAGAGCTCATACATGG + Intergenic
957142603 3:76381233-76381255 TTGGTTACTGAGCTCAGCCTAGG + Intronic
957695580 3:83634735-83634757 ATGGATACAGAGCTCAGAGAGGG - Intergenic
960284344 3:115810488-115810510 ATGGTATCAGAGGTAAGACCTGG + Intronic
960428661 3:117541622-117541644 AAGGTTATAGAGCTTATACCTGG - Intergenic
962940108 3:140117807-140117829 AAGGTTACAGAGCTCAGGGCAGG + Intronic
966338833 3:178902597-178902619 ATGGTTTCAGAGGACAGACCTGG + Intergenic
968392856 4:207104-207126 AAGGCTACAGAGCTCAGAAGTGG + Intergenic
968421590 4:489442-489464 ATGGGAAGAGAGCCCAGACCTGG + Intronic
969251940 4:5973860-5973882 ATGGATGCAGAGCTCCCACCAGG + Intronic
971571182 4:28213063-28213085 ATTGTTACAGAGCTAGGAGCAGG + Intergenic
972376084 4:38471714-38471736 ATGGTAACAGAGTTCTGCCCTGG - Intergenic
974177946 4:58347950-58347972 ATGTTTACAGAGTTCAGTCCTGG + Intergenic
983595184 4:169458221-169458243 ATGGATACAGAGTTCAGAAATGG + Intronic
986259787 5:6134406-6134428 ATGGTCGCGGAGCTCACACCCGG + Intergenic
986808411 5:11330523-11330545 ATGGTTACAGAGTTCAGGCTGGG + Intronic
987293646 5:16531253-16531275 AAGGTTACAGAGCTCATAAATGG + Intronic
992861986 5:80920591-80920613 ATGGTGACAGAGATCAGACTAGG - Intergenic
997793060 5:136779926-136779948 GTGGTTACAGAGCTGAGGCTGGG - Intergenic
999864810 5:155689207-155689229 TTTTTTCCAGAGCTCAGACCAGG + Intergenic
1003798636 6:9635377-9635399 TTAGTTTTAGAGCTCAGACCAGG + Intronic
1006429991 6:33989451-33989473 ATGGCCACATAGCTCAGACGAGG - Intergenic
1007667744 6:43525557-43525579 ATGGAGACAAAGCTCAGGCCTGG + Intronic
1008990817 6:57599239-57599261 ATGGATTAAGAGCTCAGGCCGGG - Intronic
1011986538 6:93454209-93454231 GTGGTTAAAGACCTCAGAACTGG - Intergenic
1014987067 6:128024204-128024226 ATGTTTACAGAGCTCTTACAAGG - Intronic
1016835614 6:148473611-148473633 AAGGTCACAGAGTTCAGACCTGG - Intronic
1018043414 6:159945114-159945136 ATGGTTTCAGAGGACAGGCCAGG + Intergenic
1018491779 6:164301422-164301444 ATGTTTAAAGAGGTCAGACATGG - Intergenic
1019564141 7:1671220-1671242 AAGGTCACACAGCTGAGACCTGG - Intergenic
1020736793 7:11960048-11960070 ATGAATACAGAGCTCAAACCAGG + Intergenic
1024612232 7:51077232-51077254 ATGATTAAAGACCACAGACCTGG + Intronic
1025813703 7:64890815-64890837 AAGGCTACAGAGCTCAGAAGTGG + Intronic
1027881152 7:83838809-83838831 ATAGTTACAAAGCTCTGATCTGG + Intergenic
1029195958 7:98805588-98805610 CTGGTTTCAGTGCTCAGCCCAGG - Intergenic
1029714778 7:102319957-102319979 ATGGTCACAGAGCACAGAGCAGG - Intronic
1035174964 7:157044059-157044081 GTGGCTGCCGAGCTCAGACCCGG + Intergenic
1037899563 8:22679694-22679716 ATAGTGACTGAGTTCAGACCGGG + Intergenic
1038438800 8:27557587-27557609 ATGGAGACAGAGCTCAAAGCCGG - Intergenic
1039651204 8:39340869-39340891 ATGGTTTCAGAGAACAGGCCTGG - Intergenic
1044657968 8:94568062-94568084 CTGGTTACAGAGCACTGTCCTGG - Intergenic
1048598648 8:135894719-135894741 ATGTTCACAGAGCACAGAGCAGG - Intergenic
1051754152 9:20377395-20377417 ATGGCTACAGGGCTCAGTACTGG + Intronic
1053602787 9:39627598-39627620 ATGGTTACAGAGCCAAGTCAAGG + Intergenic
1053860432 9:42381345-42381367 ATGGTTACAGAGCCAAGTCAAGG + Intergenic
1054250750 9:62714838-62714860 ATGGTTACAGAGCCAAGTCAAGG - Intergenic
1054564859 9:66749350-66749372 ATGGTTACAGAGCCAAGTCAAGG - Intergenic
1055301456 9:74887371-74887393 ACGGGCACAGATCTCAGACCCGG - Intronic
1057277335 9:93682973-93682995 ATGGGCACAGAGCTCAGGCTAGG - Intergenic
1059695392 9:116725647-116725669 ATGGTCACACAGCTTAGACGTGG + Intronic
1059734241 9:117085717-117085739 GGGGTTACAGAGCTGATACCAGG + Intronic
1059920376 9:119153912-119153934 ATGCTTACTGAGCACATACCTGG + Intronic
1062399762 9:136367245-136367267 ATGACCACAGAGCTCCGACCTGG - Exonic
1186443144 X:9603543-9603565 ATGGTTACCAAGCTCAGCCCGGG - Intronic
1187096081 X:16150148-16150170 AGGGTCACAGAGCTCAGAGTCGG + Intronic
1187458965 X:19468045-19468067 AGTGGTACAGAGCTCTGACCAGG + Intronic
1187670777 X:21664258-21664280 GTGGCTACAGAGGGCAGACCTGG + Intergenic
1194577552 X:95631978-95632000 ATAGTTATAGAGCTCTGACCAGG + Intergenic
1196175666 X:112636715-112636737 AGGGTTAAAGAGCTGAGACCTGG - Intronic
1200756443 Y:6994775-6994797 ATGGTTACCAGGCTCAGCCCGGG - Intronic