ID: 1172752171

View in Genome Browser
Species Human (GRCh38)
Location 20:37258552-37258574
Sequence CCTCCAGCTCTGCAGGTACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 311
Summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 277}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172752171_1172752176 -8 Left 1172752171 20:37258552-37258574 CCCTGTACCTGCAGAGCTGGAGG 0: 1
1: 0
2: 2
3: 31
4: 277
Right 1172752176 20:37258567-37258589 GCTGGAGGGAGCAGCAGCCCAGG 0: 1
1: 0
2: 8
3: 77
4: 613
1172752171_1172752177 1 Left 1172752171 20:37258552-37258574 CCCTGTACCTGCAGAGCTGGAGG 0: 1
1: 0
2: 2
3: 31
4: 277
Right 1172752177 20:37258576-37258598 AGCAGCAGCCCAGGCCTCAGTGG 0: 1
1: 1
2: 4
3: 79
4: 509

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172752171 Original CRISPR CCTCCAGCTCTGCAGGTACA GGG (reversed) Intronic
900485912 1:2922697-2922719 TCTCCAGGGCTGCAGGTTCAGGG - Intergenic
900795719 1:4707138-4707160 CCCCCAGAGCTGCAGGCACATGG - Intronic
902565591 1:17309281-17309303 TCTCCAGCTGTGCAGCTGCAAGG + Intronic
902574961 1:17371990-17372012 CCTGCAGCTCTGCAGGCACGAGG + Intergenic
903347515 1:22696470-22696492 CACCCAGTTCTGCAGGTACCTGG - Intergenic
905443691 1:38010627-38010649 CCTCCAGCTCAGGAGCTCCAGGG - Intronic
906075249 1:43047245-43047267 GCTCCAGCTCTGGAGTTACAGGG + Intergenic
906202955 1:43971645-43971667 CCTCCTGCTGTCCAGATACAGGG + Exonic
907557303 1:55355485-55355507 CCTCCACCTCTGCAGGGCCAAGG - Intergenic
907652492 1:56309182-56309204 GCTCCAGCTCTGCAGTTGGAAGG - Intergenic
909786652 1:79622069-79622091 CCTCCAGCTATGCAGGTTGAGGG - Intergenic
912697161 1:111850114-111850136 TCTCCAGCTCTGCAGAGAAAAGG - Intronic
916012016 1:160714682-160714704 CCTGCAGCTCAGCAGGTCCTGGG + Intergenic
916208141 1:162335319-162335341 CCTACAGCTCAGCAGCAACAGGG - Intronic
919505268 1:198390511-198390533 CTTCAGGCTCTGCAGGTACTGGG - Intergenic
920261727 1:204692912-204692934 CCTCAGGTTCTGCAAGTACAGGG - Intergenic
922192614 1:223332818-223332840 CCTCCAGCTAAGCGGGTACTGGG + Intronic
923243227 1:232106062-232106084 CCTCCTGCTCTGCAGGTGAAGGG - Intergenic
1064434687 10:15301043-15301065 CCTCCAGCTCTCCATGTCCTTGG - Intronic
1065137964 10:22691284-22691306 CTTCCAGCTCTGTAGTTAAAAGG + Intronic
1066449097 10:35511840-35511862 TCTCCATCTCTCCAGGTTCACGG - Intronic
1068006647 10:51398838-51398860 GCTCCAGGTCTTCAGGAACAAGG - Intronic
1068801562 10:61146337-61146359 GCTCCAGGTCTGCTTGTACAAGG + Intergenic
1070083025 10:73207253-73207275 CCTGCAGCTTTCTAGGTACAGGG - Intronic
1070986663 10:80695460-80695482 TCACCAGCTCTGCAGTTGCAGGG - Intergenic
1075209157 10:120476230-120476252 CCTCCAGCTCTCCAGCCCCAGGG + Intronic
1075644135 10:124086516-124086538 CCTCCAGCTCCGCAGGCAATGGG + Intronic
1075844379 10:125533849-125533871 CCGACTGCTCTGCAGCTACACGG - Intergenic
1076752305 10:132549668-132549690 CCTGGAGCTCTGCAGCTGCAGGG + Intronic
1076796899 10:132802852-132802874 GCCCCAGCCCTGCAGGGACAGGG - Intergenic
1077147753 11:1053535-1053557 CCTACAGCTGGGCAGGTCCATGG - Intergenic
1077392633 11:2307148-2307170 CCTCCAGCCCTGCAGGGACAGGG - Intronic
1078600835 11:12728962-12728984 CCTCCAGCTTTGCAGGTGTCAGG - Intronic
1078886019 11:15500678-15500700 ACTCCAGGTCTGCAGGCACAAGG + Intergenic
1083078997 11:60071823-60071845 TCTCTAGCTGTGCAGGTGCAAGG - Intergenic
1083109166 11:60388066-60388088 ACTCCAGCTCTGTAGCTATATGG + Intronic
1083327810 11:61882015-61882037 GCCCCAGCTCTGCAGGTAGCTGG - Intronic
1083679340 11:64344026-64344048 CCTCCAGCACTGGAAGAACAGGG - Exonic
1084693959 11:70743013-70743035 CCACCAGCACTGCAGCCACATGG - Intronic
1085444374 11:76590624-76590646 CCTGGAGGCCTGCAGGTACATGG + Intergenic
1086136707 11:83449062-83449084 CCTCCAGCTGTGCAGTCATAGGG + Intergenic
1086981148 11:93198634-93198656 GCTCCAGCTCTGAAGGCAGAAGG - Intergenic
1087149375 11:94844898-94844920 CCTCTATCTCTCCAGCTACATGG + Intronic
1087202174 11:95356850-95356872 CCTCTAGGAATGCAGGTACATGG - Intergenic
1088828505 11:113515728-113515750 ACTCCATCTCTTCAGGGACAAGG + Intergenic
1089045956 11:115502972-115502994 CCTGCAGCTCTGGAGCTGCAAGG + Intronic
1090476600 11:127027546-127027568 GCTCCAGCTTTCCAGGGACAAGG + Intergenic
1092519055 12:9247663-9247685 CCTCCAGCTCTAAAGGTAAATGG + Intergenic
1092881894 12:12893131-12893153 CTCCCAGCTCCGCAGGAACATGG + Intronic
1093299752 12:17439558-17439580 CCTGCAGCTTTTCAGGTACATGG + Intergenic
1095871498 12:47033289-47033311 TCTGCCGCTCTGCAGGGACAAGG + Intergenic
1095938589 12:47711070-47711092 CCTCCAGCTCCCCATGTGCAAGG + Intronic
1096487067 12:51990396-51990418 CCTCCACCTCTCCAGGCTCAGGG + Intronic
1096536341 12:52277537-52277559 CCGCCAGCTCTGCAGGAGGAGGG + Intronic
1097167740 12:57094598-57094620 CCTCGAACTCTGCAGGGAAAAGG - Exonic
1097692765 12:62748702-62748724 CCTCCAGCTCAGAAGGTTCATGG + Intronic
1098568897 12:71967227-71967249 CCTTCTTCTCTGCAGGCACAAGG + Intronic
1099256963 12:80326098-80326120 CCTCAAGTACTGCAGGTATAAGG - Intronic
1101773638 12:107774717-107774739 CCGCCAGATCTGCAGGTTCCTGG + Exonic
1102118456 12:110421612-110421634 TCTCTAGCTGTGCAGCTACAAGG + Intergenic
1102709627 12:114914743-114914765 CCTCAAGCCCTGCAGATACAAGG - Intergenic
1102800025 12:115724016-115724038 CTTCAAGCTCTGGAGGTTCATGG + Intergenic
1104185573 12:126427215-126427237 GCTCCACATCTGCAGTTACAAGG + Intergenic
1105064057 12:133181606-133181628 CCTCCAGATCTGCAGCCAGAAGG - Intronic
1105559947 13:21480875-21480897 CCTCCAACAGTGCAGGGACATGG + Intergenic
1106030508 13:25998123-25998145 GCTCCTGCTCTCCAGGTGCAGGG + Intronic
1107192885 13:37610892-37610914 CCTCTTGCTCTCCAGATACATGG - Intergenic
1108270259 13:48752229-48752251 CCTTTAGCTGTGCAGCTACAAGG + Intergenic
1108454924 13:50603817-50603839 CCTCCACCTCCTCAGGCACAGGG + Intronic
1112790239 13:102995148-102995170 CCTGCAGCTTTTCAGGTTCATGG + Intergenic
1113088336 13:106591771-106591793 CCTCCAGCTCACCAAGTCCAGGG + Intergenic
1113253693 13:108484161-108484183 CCTCCTGCTCTGCAACTGCAGGG - Intergenic
1113692908 13:112324298-112324320 CCTCCAGCTCTGCAGGAGGCTGG - Intergenic
1113852534 13:113426054-113426076 CGCCCTGCTCTGCAGGCACAGGG - Intronic
1114320495 14:21543338-21543360 CCTCCAGGTCTGCAGCCAGAAGG - Intergenic
1114602392 14:23967204-23967226 CCTGCAGCTCTGGATGGACAAGG + Exonic
1114606760 14:24004330-24004352 CCTACAGCTCTGGATGGACAAGG + Exonic
1114612061 14:24049278-24049300 CCTGCAGCTCTGGATGGACAAGG + Intergenic
1115003858 14:28455908-28455930 CCTCCAGCTCTGTTGCTAAATGG + Intergenic
1116257164 14:42571132-42571154 CTTCCATCCCTGCAGGTTCAGGG + Intergenic
1118001446 14:61527149-61527171 CCTCAAGGTCGGCAGGAACATGG - Intronic
1118318325 14:64738727-64738749 CCTCTACCTCTGCAGGGAAAGGG + Exonic
1119119495 14:72061058-72061080 CCTCCTCCTCTGAAGGTAGATGG + Intronic
1119436422 14:74600574-74600596 CCTCCAGCCCTGGAGGTTCTCGG - Intronic
1121123855 14:91393344-91393366 CCCCCAGCCCTGCAGGCAGAGGG + Intronic
1121202375 14:92129120-92129142 CCTCCTGCTTTTCAAGTACAGGG + Intronic
1122136482 14:99635727-99635749 CCTGCAGCTCAGGAGGGACATGG + Intergenic
1122790632 14:104182839-104182861 CCTGCAGGTGAGCAGGTACAGGG - Intergenic
1122903607 14:104792112-104792134 CAGCCAGCTCTGCAGCTCCAAGG + Intronic
1123123707 14:105929834-105929856 CCTCCAGCGTTGCAAGTGCAAGG + Intronic
1123406340 15:20021325-20021347 CCTCCAGCGTTGCAAGTGCAAGG + Intergenic
1123515670 15:21027973-21027995 CCTCCAGCGTTGCAAGTGCAAGG + Intergenic
1124208145 15:27740747-27740769 TGCCCAGCTCTGCTGGTACACGG - Intergenic
1124650306 15:31469259-31469281 CCTCCATCCCTGCAGGCTCAGGG - Intergenic
1126683498 15:51226563-51226585 CCCCCATCTCAGCAGGCACATGG + Intronic
1128260402 15:66228952-66228974 CCGCCAGGTCTGCAGGGACTTGG - Intronic
1128538050 15:68505294-68505316 CCTTGAGCTCTACAGGGACAGGG + Intergenic
1129356406 15:74995127-74995149 CCTTCAGATCTGCAGGCGCAGGG - Intronic
1130090498 15:80816780-80816802 CTTGGAGCTGTGCAGGTACAAGG - Intronic
1130383516 15:83392242-83392264 CCTCCCTCAGTGCAGGTACAAGG + Intergenic
1131643354 15:94315514-94315536 TCTCCATCTGTGCAGGTACCGGG + Exonic
1131953449 15:97706174-97706196 GCTCCACCTGTGCAGGGACAGGG - Intergenic
1132035062 15:98475838-98475860 CCACCAACTTTGCAGGTACAGGG + Intronic
1134038658 16:11051203-11051225 TCTCCACCTCAGCAGGGACAGGG - Intronic
1134057604 16:11180337-11180359 CCTTCATGGCTGCAGGTACAAGG + Exonic
1135228413 16:20681905-20681927 TCTCCAGCTGTGCAGCTGCATGG + Intronic
1135244103 16:20839605-20839627 CTTCCAGGTCTGCAGGAAAATGG - Intronic
1136161452 16:28422319-28422341 CCTCCACCTCCCCAGGTTCAAGG + Intergenic
1137607622 16:49797029-49797051 CCACCACCTCTGCTGGGACAGGG - Intronic
1138190055 16:55007509-55007531 CCCCCTCCTCAGCAGGTACACGG - Intergenic
1139622330 16:68155965-68155987 CCTCCATCTCTTCATGTATACGG - Intronic
1139825609 16:69754840-69754862 CATGCGGCTCTGCAGGTACGGGG - Exonic
1141506472 16:84481600-84481622 CCCTCAGCTCTGCAGAAACAGGG + Intronic
1142107889 16:88316007-88316029 CCTACAGAGCTGCAGGTGCATGG - Intergenic
1142859275 17:2751030-2751052 CTCCCAGCTCTGAAGGTACAGGG - Intergenic
1143471334 17:7177827-7177849 CCTCCAGCTCTCAGGGCACAGGG - Intronic
1144132961 17:12265830-12265852 CCTCCATTTCTTCAGGTCCATGG - Intergenic
1144484644 17:15654613-15654635 TCTCTAGCTCTGCAGCTGCAAGG + Intronic
1147732809 17:42614438-42614460 CCTCTACCCCTGCAGGTCCAGGG - Intronic
1147740066 17:42666265-42666287 CCTCTACCCCTGCAGGTCCAGGG - Intronic
1149399888 17:56285284-56285306 CCTCCAGCCCAGCAGTTCCAGGG - Intronic
1150620765 17:66806418-66806440 CCTGCAGGGCTGCAGGGACAGGG - Exonic
1151427871 17:74042936-74042958 CCTCCAGCTCTCCATGGAGAAGG - Intergenic
1152598607 17:81250321-81250343 CCTTCCGCGCTGCAGGTGCAAGG + Intronic
1152741333 17:82019777-82019799 CCTGCAACTCTGCAGGGCCAAGG - Intronic
1152923596 17:83078004-83078026 CCCCCATCACTGCAGGTACCAGG - Intergenic
1203169553 17_GL000205v2_random:135405-135427 CCTCAAGCTCTACAGGCACTAGG - Intergenic
1153596455 18:6729929-6729951 CCACCCGCTCAGCAGGTACCCGG + Intronic
1155341992 18:24822442-24822464 CCTCTAGGTCTGAAGGAACAAGG + Intergenic
1156879944 18:42064994-42065016 ACTCCAGCCCTGCAGTCACAGGG + Intronic
1162726109 19:12690436-12690458 GCTCCAGCTCTGCCTGGACAAGG + Intronic
1162986316 19:14272461-14272483 CCTCCAGCTCTGAAGGAATGTGG + Intergenic
1163514697 19:17755820-17755842 CCTTCAGCCCTGCAGGACCAGGG + Intronic
1165014306 19:32869692-32869714 CCTCCGGCTCTGCAGGGTCACGG - Exonic
1165027010 19:32969564-32969586 CCTCCATCCCTGCAGGCTCAGGG - Intronic
1165052531 19:33151123-33151145 CCTCCAGCCCAGCAGGTGGAAGG + Intronic
1165307530 19:35011618-35011640 CCTCCAGCTCCGCAAGTTCTGGG - Intronic
1166181781 19:41114007-41114029 ACTCCAGCTCTGGAGGGAAAGGG + Intergenic
1166181886 19:41114478-41114500 CCTGCAGCTCAGCAGGTAAAGGG + Exonic
1166507557 19:43380602-43380624 CCTGCAGCACTGCCGGTACTGGG + Intergenic
1167308418 19:48721866-48721888 CCTCCCGCTCTGCAGGGGGAGGG + Exonic
1168095008 19:54109502-54109524 GCTCCAGTTTTGCTGGTACAGGG + Intronic
926037227 2:9645347-9645369 CCTCCAGCTCTGCTGCTGCTGGG + Intergenic
926293651 2:11551469-11551491 TCTCTAGCTCTGCGGGTCCAGGG + Intronic
926297945 2:11582083-11582105 GGTCCAGCTCTGCAGCCACAGGG - Intronic
927151744 2:20200184-20200206 CCTCCTGCTCTGCAGGGCCCAGG + Intergenic
928500360 2:31886709-31886731 AGTCCAGTTCTCCAGGTACATGG - Intronic
932668572 2:73717820-73717842 CTTCCAGCCTTGCAGGAACAGGG + Intergenic
932716893 2:74107220-74107242 CCTGCAGCTCTGCAGGAGGAAGG - Exonic
933372114 2:81427863-81427885 CCTCCAGCTTTGCAAATAAAAGG - Intergenic
933472248 2:82740762-82740784 CCTCCTGCTCTCCAGGTGCTGGG - Intergenic
934730286 2:96652195-96652217 CCACCAGCTCCTCAGATACAGGG - Intergenic
935659615 2:105454868-105454890 CCTCCTGCTGTGCAGGTACCGGG + Intergenic
936061542 2:109298332-109298354 GCTCCAGAACTGCAGGGACAAGG - Intronic
936777764 2:115994620-115994642 CCTACAGCTTTCCAGGTGCAGGG - Intergenic
937037519 2:118794209-118794231 CCTACAGTTGTGCAGGCACAGGG - Intergenic
937476891 2:122223630-122223652 CCTCCAACTCTGCAGGCATCAGG - Intergenic
938843102 2:135181787-135181809 GCTGCTGCTCTCCAGGTACATGG + Intronic
940332087 2:152485908-152485930 CCTCAGGCTGTGCAGGGACATGG + Intronic
941615587 2:167714777-167714799 TCTCCAGCTCTTCAGTGACATGG + Intergenic
941721040 2:168813215-168813237 CTTCCTGCTCTGCAGGCAGAAGG - Intronic
942103970 2:172614186-172614208 CCCCCATCCCTGCAGGTTCAGGG + Intergenic
942446681 2:176082964-176082986 CCTCCAGCCCTGAGGGCACAGGG + Intronic
943698693 2:190965290-190965312 AATCCAGCTCTGCAGCTAAAGGG - Exonic
944677626 2:202047396-202047418 CCTGCAGTTCTGCAGGTTCTTGG + Intergenic
945934337 2:215887564-215887586 CCGCCACCTCAGCAGCTACATGG - Intergenic
946051269 2:216864409-216864431 CATCCAGTTCTGGAGGTACAGGG + Intergenic
947900817 2:233719967-233719989 CCTTCAGCTCGGCAGGATCAGGG + Intronic
947902187 2:233730299-233730321 CCTTCAGCTTGGCAGGAACAGGG + Intronic
948082840 2:235220542-235220564 CCACCAGCTCTGCATGTGGAGGG - Intergenic
948307245 2:236957418-236957440 CCCCCAGCCCTGCATGTGCAGGG + Intergenic
948455719 2:238103777-238103799 CCTCAGGCTCTGCAGGTGCAGGG + Intronic
948795794 2:240401510-240401532 CCTCCCGCTCTGTGGGCACAGGG - Intergenic
949070698 2:242022443-242022465 CCTCCAGGTCTCCAGCTGCAAGG - Intergenic
1169252700 20:4072513-4072535 CCTCCAGCTGATCAGGTACATGG - Exonic
1169288756 20:4331220-4331242 CCTGTAGCTCTGCAGAAACAGGG + Intergenic
1169889551 20:10437385-10437407 TCTCAATCTCTGCAGATACAGGG - Intronic
1171232112 20:23495672-23495694 CCTCTAGCTCTGCAGATTCCTGG + Intronic
1171422525 20:25026777-25026799 TGTGCAGCTCTGCAGGTACCAGG - Intronic
1172752171 20:37258552-37258574 CCTCCAGCTCTGCAGGTACAGGG - Intronic
1173469867 20:43314727-43314749 CCTCCAGACCAGCAGGTCCATGG + Intergenic
1173890722 20:46507626-46507648 CCTCCACCTCTGCAGACACCTGG + Intronic
1174269048 20:49353649-49353671 TCTCCAGCTCAGCAGGTCCTTGG + Intergenic
1175464812 20:59183332-59183354 GCTGCAGCCTTGCAGGTACAGGG + Intergenic
1175942681 20:62545208-62545230 CCCACAGCTGTGTAGGTACAGGG - Intergenic
1176402202 21:6323744-6323766 CCTCAAGCTCTACAGGCACTAGG + Intergenic
1176434955 21:6665360-6665382 CCTCAAGCTCTACAGGCACTAGG - Intergenic
1176459217 21:6992430-6992452 CCTCAAGCTCTACAGGCACTAGG - Intergenic
1177587754 21:23120192-23120214 CCTCCAGTGTTGCAGGTACTGGG + Intergenic
1179218281 21:39385604-39385626 TCTGCAGCTCTGCGGGTGCAGGG + Intronic
1180839927 22:18954539-18954561 TGTCCAGATCTGCAGGTAGATGG + Intergenic
1180977341 22:19855519-19855541 CCCCCAGGTATGCAGGTAGAGGG - Intergenic
1181341715 22:22186103-22186125 CCACCAGGTCTGCAGCTAGAGGG - Intergenic
1181415046 22:22753311-22753333 CCTCCAGCTCTTCATTTACAAGG + Intronic
1182297174 22:29316395-29316417 CCTCCAGCCTTGCTGGGACAGGG - Intronic
1182576784 22:31278363-31278385 CCTCCAGCTCTGCAGGCAGCGGG - Intronic
1183818800 22:40327118-40327140 ACTCCAGCTCGACAGGTAAAGGG + Exonic
1183834039 22:40437276-40437298 CGTCCTGCTCTGCAGGAACCCGG + Intronic
1184074043 22:42164883-42164905 CCTCCAGCTCCTCAGGGACCAGG - Intronic
1184684022 22:46087949-46087971 CCTCCAGGGCTGCAGCTGCAGGG + Intronic
1185083100 22:48720600-48720622 CCTCCGGCTATGCAGGTGCGGGG + Intronic
1185090103 22:48761756-48761778 CCACCGGCTCTGCAGCTTCAGGG + Intronic
1185285171 22:49996852-49996874 CCTCCAGCCCTGCAGGCATAAGG + Exonic
949233008 3:1773578-1773600 CCTCCTTCTCTGCAGGCACTAGG - Intergenic
950667190 3:14504815-14504837 TCTCCAGCTCTGTAAGAACAGGG - Intronic
952980418 3:38729491-38729513 ACTCCAGCCGTGCAGGTGCATGG + Intronic
952983449 3:38756863-38756885 CCTCAGGGTCTGCAGGTTCAAGG + Exonic
953705807 3:45229330-45229352 CCTCCAGCTCGGCAGGGACCTGG + Intergenic
953878846 3:46681301-46681323 CCCCCAGCCCTTCAGGTACACGG - Exonic
954574025 3:51664990-51665012 CCTCCATCTTTGAAGGAACATGG + Exonic
954632466 3:52055037-52055059 CCTCCCCCGCTGCAGGTCCAAGG - Intronic
954752862 3:52823495-52823517 CCTCCACCTCTGCAGCCAGAGGG - Intronic
954812600 3:53257229-53257251 CTTCCAGGTCTGTAGGGACAGGG + Intergenic
959833703 3:110893604-110893626 CAGCCAGCTTTGCAGGAACAAGG + Intergenic
962350014 3:134649877-134649899 CCTCCAGCTCTGGAGCTCCTTGG - Intronic
964957898 3:162383781-162383803 CCTCAATTTCTGCTGGTACAGGG - Intergenic
965046469 3:163584643-163584665 CCTGCAGCTTTTCAGGTTCATGG + Intergenic
965600731 3:170452053-170452075 CACCCAGCTCTCCAGGTTCATGG - Intronic
966646599 3:182252504-182252526 CCTCCACCTCTCCAGGGACCAGG - Intergenic
967862388 3:194161787-194161809 GCTGCAGCTCTCCAGGTATAGGG + Intergenic
968097248 3:195940606-195940628 CCGCCAGGTCTCCAGGTGCACGG + Intergenic
968105618 3:195999448-195999470 CCACCAGATCTCCAGGTGCATGG + Intergenic
968132229 3:196198444-196198466 CCTGCTGCTCCCCAGGTACATGG - Exonic
968816698 4:2825112-2825134 CATCCAGCTCTGCAGGTCAGCGG - Exonic
969407069 4:7000577-7000599 CCTTCAGCTCTGCTGGGACACGG - Intronic
969522435 4:7686493-7686515 CCTCCAGCCCTGCAGGAACCCGG + Intronic
971009603 4:22418791-22418813 CCTCCTGTTCTGCAGGCACCAGG + Intronic
971375983 4:26056203-26056225 CCAGCACCTCTGCAGGTGCATGG - Intergenic
974260369 4:59518328-59518350 CTTCCAGCCCTGCAGGGGCAGGG + Intergenic
975713850 4:77187103-77187125 CCTCTAGGCCTGAAGGTACAAGG - Intronic
976223255 4:82775082-82775104 CCTCCAGCTCAGCCAGCACAGGG + Intronic
976508847 4:85883518-85883540 CATCCAGTTCTGCATGTGCAGGG + Intronic
977632095 4:99254399-99254421 CCTCCATATCTGCAGGTTCTGGG - Intergenic
983264565 4:165494385-165494407 ACTCCAGCTTTTCAGGGACAAGG + Intronic
985470977 5:45749-45771 CCTCCAGCTGTGCAGGTGACAGG - Intergenic
985692275 5:1319917-1319939 CCTCCAGCTCTGCTGTGCCAGGG - Intronic
985806639 5:2049215-2049237 CTTCCAGCTCTGAAGGAACACGG - Intergenic
985889286 5:2703111-2703133 CCTCTATCTCTGCATGTACCAGG - Intergenic
985999561 5:3619898-3619920 CCCCCAGCCCTGCAGGGACCTGG + Intergenic
987081957 5:14433360-14433382 CCTCCTGCTCTGGAGGGAAAGGG - Intronic
989286826 5:39709932-39709954 CGTCCAGCTATACAGCTACAAGG - Intergenic
990292030 5:54361969-54361991 CTTCCAGCTGTGGAGGCACAAGG + Intergenic
990514795 5:56521112-56521134 CCAGGAGCTCTGCAGGGACATGG + Intronic
991698870 5:69298685-69298707 CCTCCAGCCAGGCAGGAACAAGG - Intronic
992794106 5:80239996-80240018 CCTGAAGCTCTGCAAGTCCAAGG + Intronic
996339837 5:122424263-122424285 CTTCCAGCTCTGCATGTCTAGGG + Intronic
999058449 5:148607596-148607618 GCTCCATCTCTGGAGGCACATGG - Intronic
1000172837 5:158720333-158720355 CATCCAGCTCTGCAGGAAATGGG - Intronic
1002436359 5:179234298-179234320 TCTCCAGCTCTGCATGGAGAAGG + Intronic
1002643538 5:180641692-180641714 CCTTAAGCTCTGAAGGCACAGGG - Intronic
1002957569 6:1882218-1882240 CCTCCAGCTCTGAGGGACCAAGG - Intronic
1003563714 6:7204612-7204634 CCTCCAGCTTGGCAGGTCCTGGG + Intronic
1006630670 6:35427681-35427703 CCTCCAGGCCTGCAGGGGCAAGG + Exonic
1007978713 6:46128775-46128797 CCTCCAGCTCTGAAAGCCCATGG + Intergenic
1010543229 6:77118224-77118246 CTTCCAGCTCTGAAGCTATAAGG + Intergenic
1011518153 6:88174916-88174938 CCTCCAGCCCGCCAGGTTCAAGG - Intergenic
1012592697 6:101002056-101002078 CCTCCAGAGATCCAGGTACACGG - Intergenic
1018676590 6:166227486-166227508 TCTTCAACTCTGCAGTTACAAGG + Intergenic
1018733092 6:166668093-166668115 ACTCCAGCTCTCCAGGAACCTGG - Intronic
1019280011 7:194869-194891 CCTCCAGCCCAGCAGGCAGACGG + Intronic
1019519663 7:1454925-1454947 CCTCCAGAGCTGCAGGGACCAGG + Intronic
1019919196 7:4152116-4152138 CCTCCAGCTCTGTGAGTCCAAGG + Intronic
1023204256 7:37731281-37731303 TCCCCACCTATGCAGGTACAAGG - Intronic
1023689027 7:42766993-42767015 CTTCCACCTCTGCAGCTAGATGG + Intergenic
1023875053 7:44282350-44282372 CTTCCAGCTGTGCAGTCACAGGG + Intronic
1024519999 7:50297221-50297243 CCACTAGCTCTGCAGGTATCAGG - Intergenic
1026731435 7:72914997-72915019 CCTCCACCTCTGCAGGGAAGAGG + Intronic
1026824747 7:73574375-73574397 GCTGCAGCTCTGAAGGTACGTGG - Exonic
1028426822 7:90698890-90698912 CCTGCAGCTTTGTAGTTACAAGG + Intronic
1029188717 7:98756975-98756997 TCTCCAGCTCTGCAGGCAGGTGG - Intergenic
1029737404 7:102472478-102472500 CCTCCAGCTCCACAGGCAGATGG - Exonic
1031973372 7:128079167-128079189 CTTCCAGCTCTGGAGGCCCAGGG + Intronic
1032946322 7:136857018-136857040 TCTCCCTCTTTGCAGGTACAAGG - Intergenic
1033288569 7:140062553-140062575 GCTCCACCTCTGCAGGTTCATGG - Exonic
1035434612 7:158850096-158850118 TCCCCAGCTCTGCAGGCTCAGGG - Intergenic
1035560499 8:600835-600857 CCTCTAGCTTTGCAGTTCCAGGG - Intergenic
1035642460 8:1194401-1194423 CCTCCAGCTCTGCCTAGACACGG - Intergenic
1036770745 8:11576999-11577021 CCTCCAGCTCTGAGGGTCTAAGG - Intergenic
1038516967 8:28195559-28195581 TGTCCAGCTCTGCAGGGACAGGG + Intergenic
1039840448 8:41289238-41289260 CCTCCAGCTCTGCAGTTAGGTGG - Intronic
1039882216 8:41632178-41632200 CCTCCATGCCTGCAGTTACATGG - Intergenic
1041553731 8:59129534-59129556 CCTCCAGCTCTTCATGTTCTAGG + Intergenic
1042396002 8:68292683-68292705 CCGCCATCCCTGCAGGTTCAGGG + Intergenic
1042784663 8:72535198-72535220 GCTCCAGCTCTGCATTTCCAGGG - Intergenic
1045397016 8:101771269-101771291 CCTCCAGATCAGCAAGTTCAGGG + Intronic
1045957869 8:107930454-107930476 CCTCCAGTTCTGAAGCTGCAAGG + Intronic
1046645585 8:116782223-116782245 CCTCCACGTCTGCAGTCACAGGG + Intronic
1047048021 8:121076582-121076604 CCTGCAGCTCTGCATTTATATGG + Intergenic
1049528818 8:143143061-143143083 TCTCCAGCTCTGCAGGTCCAGGG + Intergenic
1055334940 9:75224038-75224060 CCTGCAGCTTTCCCGGTACATGG + Intergenic
1057043714 9:91867202-91867224 CTTCCAGCTCTGCTGGAGCAGGG + Intronic
1057722614 9:97545118-97545140 CCTCTAGCTCTGCAAATGCAGGG + Intronic
1058171802 9:101690500-101690522 CCTGCAGCTCTGCACTTACTTGG - Intronic
1058686939 9:107488259-107488281 CCGCCAGCGCTGCGGGGACAGGG + Exonic
1060749440 9:126159340-126159362 GCTCCAGCTCTGCTGGGACAAGG - Intergenic
1060933126 9:127501192-127501214 CCTCAAATTCTGCAGGTACAGGG + Intronic
1062051107 9:134447531-134447553 TCACCAGCTCAGCAGGTCCAGGG - Intergenic
1062495905 9:136831564-136831586 CCTCTAGCTCTGCATGCACGAGG + Intronic
1203436581 Un_GL000195v1:143287-143309 CCTCAAGCTCTACAGGCACTAGG + Intergenic
1185999633 X:4993963-4993985 ACTCAAGTTCTGCAGGAACATGG + Intergenic
1187955947 X:24518973-24518995 CTTCCAGCTCTGGAGCTACCAGG - Exonic
1189952727 X:46248901-46248923 CCTCAAGGTCTGAAGGGACAAGG - Intergenic
1190302732 X:49065831-49065853 CCCCCAGCTCTGCAAGTAAGGGG + Exonic
1192224890 X:69221514-69221536 TCTCCAGGTCAGCAGGTCCAAGG + Intergenic
1195495116 X:105522114-105522136 CCTCCAACTCTTGAGGTCCAGGG - Intronic
1196110238 X:111939072-111939094 CCTAAAACTCTGCATGTACAAGG - Intronic
1198995563 X:142569789-142569811 CCTCCAGCTTTTCAGGGAAAAGG - Intergenic
1201264362 Y:12191788-12191810 CCTCCAGTTCTCCAGGTGGAAGG - Intergenic
1201644434 Y:16213690-16213712 TCTCCAGCTGTGCAGTTGCAAGG - Intergenic
1201658381 Y:16371631-16371653 TCTCCAGCTGTGCAGTTGCAAGG + Intergenic
1201867861 Y:18673675-18673697 CTTCCAGATCTGCAGAGACAAGG - Intergenic