ID: 1172754349

View in Genome Browser
Species Human (GRCh38)
Location 20:37272882-37272904
Sequence ACTAGGGCCTCAAGTGATTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172754334_1172754349 30 Left 1172754334 20:37272829-37272851 CCTGGACCCCAGATTCAGTTGTC No data
Right 1172754349 20:37272882-37272904 ACTAGGGCCTCAAGTGATTCTGG No data
1172754337_1172754349 24 Left 1172754337 20:37272835-37272857 CCCCAGATTCAGTTGTCCAGGGT No data
Right 1172754349 20:37272882-37272904 ACTAGGGCCTCAAGTGATTCTGG No data
1172754345_1172754349 -3 Left 1172754345 20:37272862-37272884 CCCAGGGTTCTGAATTTTTAACT No data
Right 1172754349 20:37272882-37272904 ACTAGGGCCTCAAGTGATTCTGG No data
1172754346_1172754349 -4 Left 1172754346 20:37272863-37272885 CCAGGGTTCTGAATTTTTAACTA No data
Right 1172754349 20:37272882-37272904 ACTAGGGCCTCAAGTGATTCTGG No data
1172754339_1172754349 22 Left 1172754339 20:37272837-37272859 CCAGATTCAGTTGTCCAGGGTAG No data
Right 1172754349 20:37272882-37272904 ACTAGGGCCTCAAGTGATTCTGG No data
1172754344_1172754349 8 Left 1172754344 20:37272851-37272873 CCAGGGTAGGGCCCAGGGTTCTG No data
Right 1172754349 20:37272882-37272904 ACTAGGGCCTCAAGTGATTCTGG No data
1172754338_1172754349 23 Left 1172754338 20:37272836-37272858 CCCAGATTCAGTTGTCCAGGGTA No data
Right 1172754349 20:37272882-37272904 ACTAGGGCCTCAAGTGATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172754349 Original CRISPR ACTAGGGCCTCAAGTGATTC TGG Intergenic
No off target data available for this crispr