ID: 1172759058

View in Genome Browser
Species Human (GRCh38)
Location 20:37309247-37309269
Sequence CTGTCAATCCCGACTGATAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 31
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 27}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172759058_1172759065 29 Left 1172759058 20:37309247-37309269 CCCTTATCAGTCGGGATTGACAG 0: 1
1: 0
2: 1
3: 2
4: 27
Right 1172759065 20:37309299-37309321 CACCTTCTGAGTCTCATGGAAGG 0: 1
1: 0
2: 2
3: 10
4: 131
1172759058_1172759063 25 Left 1172759058 20:37309247-37309269 CCCTTATCAGTCGGGATTGACAG 0: 1
1: 0
2: 1
3: 2
4: 27
Right 1172759063 20:37309295-37309317 TCCTCACCTTCTGAGTCTCATGG 0: 1
1: 0
2: 2
3: 15
4: 248

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172759058 Original CRISPR CTGTCAATCCCGACTGATAA GGG (reversed) Intronic
912000219 1:104823729-104823751 CTGCAAATGCAGACTGATAAAGG - Intergenic
919211054 1:194487147-194487169 CTGACAATCCTGACTTAGAAGGG + Intergenic
1071184877 10:83030877-83030899 CTGTCAATGCAGACTAATAAAGG + Intergenic
1084722478 11:70916163-70916185 CTGTGAATCCTGAGGGATAAAGG + Intronic
1088749664 11:112832938-112832960 CTGGCAATTATGACTGATAAGGG + Intergenic
1103144313 12:118581204-118581226 CTTTCAAGCCCAACAGATAATGG - Intergenic
1105469179 13:20676426-20676448 CTGTGACTCCCGCCTGACAAAGG + Intronic
1110930523 13:81210391-81210413 CTGTGAATGCAGACAGATAAAGG - Intergenic
1113161558 13:107387442-107387464 CTGTCAACCCCCACTGATTAGGG + Intronic
1121806729 14:96833316-96833338 CTGTTAATTCTGACTTATAATGG - Intronic
1137936136 16:52637270-52637292 CTGTCAATCCAGGGTGCTAAAGG + Intergenic
1141883831 16:86878544-86878566 CTGTCAATCACGGCTGATGCAGG - Intergenic
1145846956 17:28047947-28047969 CTGTTAATCTCGGCTGATAGTGG - Intronic
1147209865 17:38866674-38866696 ATTGCAATCCCGACTGATCAAGG + Intergenic
1156127193 18:33920797-33920819 CTGTCAGCCCAGACTGAAAAGGG + Intronic
1157587160 18:48810199-48810221 GTGGCTATCCCGACTGATATGGG - Intronic
939543344 2:143520408-143520430 CTCTCATTCCCTACTGATAGGGG - Intronic
940591920 2:155739880-155739902 CTGTCAATCCGGACTAATAAGGG - Intergenic
944452269 2:199855092-199855114 CTGTCACTCCAAACTAATAATGG - Intergenic
948036651 2:234863446-234863468 CTGTCAATCCCCCCTCAGAATGG - Intergenic
1172759058 20:37309247-37309269 CTGTCAATCCCGACTGATAAGGG - Intronic
1173074171 20:39800923-39800945 CTGTCTATCCTGACTTAAAAGGG + Intergenic
955636915 3:61040422-61040444 TTGTCTATCCAGAATGATAATGG + Intronic
972067439 4:34967410-34967432 CTGACAATCCTTACTGATGAAGG - Intergenic
981149045 4:141360144-141360166 CTGTGAATCCCGTCTGATCCTGG + Intergenic
983042835 4:162950918-162950940 GTGTAAATCCTGATTGATAAAGG - Intergenic
1003833061 6:10036106-10036128 CTCTCAATCCTGCCTGATAGAGG - Intronic
1016817967 6:148321036-148321058 CTATCAATCCTGTGTGATAAAGG - Intronic
1033265729 7:139884926-139884948 CTGTCCACCCTGACTGATATCGG - Intronic
1050458600 9:5857626-5857648 CTGTCAATACCATCTTATAAAGG + Intergenic
1186247271 X:7627534-7627556 CTGTTAAGCCCCACTGAGAATGG + Intergenic