ID: 1172760392

View in Genome Browser
Species Human (GRCh38)
Location 20:37317301-37317323
Sequence AGGGCCCTGCCCCGGGGATG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 378
Summary {0: 1, 1: 0, 2: 2, 3: 43, 4: 332}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172760379_1172760392 17 Left 1172760379 20:37317261-37317283 CCTGCCTGTGTTGTCTTTTGCTG 0: 1
1: 0
2: 0
3: 41
4: 381
Right 1172760392 20:37317301-37317323 AGGGCCCTGCCCCGGGGATGAGG 0: 1
1: 0
2: 2
3: 43
4: 332
1172760381_1172760392 13 Left 1172760381 20:37317265-37317287 CCTGTGTTGTCTTTTGCTGAGGG 0: 1
1: 0
2: 4
3: 24
4: 183
Right 1172760392 20:37317301-37317323 AGGGCCCTGCCCCGGGGATGAGG 0: 1
1: 0
2: 2
3: 43
4: 332

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172760392 Original CRISPR AGGGCCCTGCCCCGGGGATG AGG Intergenic
900103004 1:970813-970835 AGGGGCCTGCCCTGTGGCTGCGG + Intronic
900299542 1:1969903-1969925 AGGGCCAGGCTCCCGGGATGAGG + Intronic
900403523 1:2482630-2482652 AGGGCTCTGCCCTGGGGACAGGG + Intronic
900528731 1:3142337-3142359 GGAGCCCTGTCCCGGGGGTGCGG + Intronic
901684772 1:10937711-10937733 AGGGCCATCCCCCAGGGCTGAGG - Intergenic
901883708 1:12208529-12208551 AGGGCCCTGGCCCTGGGAGGGGG - Exonic
902559973 1:17271183-17271205 TGGGCCCTGCCCAGTGGCTGTGG - Intronic
903210621 1:21816135-21816157 GGGGCCCTGCCCTAGGGAAGGGG - Intronic
903632952 1:24790697-24790719 AAGCCCCTGCCCCTGGGATGGGG - Intronic
904471472 1:30739266-30739288 AGGGCCCTGGCCCGGGAGTCTGG - Intronic
904494333 1:30878220-30878242 ATGGCCCCGCCCTGGGGAAGGGG - Intronic
904592884 1:31625178-31625200 TGGGCCCTGGCTTGGGGATGGGG - Intronic
907358169 1:53893390-53893412 AGAGCCCTCCCCAGGGGATATGG - Intronic
911370507 1:96989403-96989425 AGGGCTCTGCCCCAGGGGTCTGG - Intergenic
911690609 1:100829665-100829687 AGGGCCCTGTCCCGGGGTGTAGG - Intergenic
912381437 1:109249981-109250003 GGCGCCCTGGCCCGGGCATGAGG + Intergenic
912494029 1:110079833-110079855 AGAGCCCAGCCCCTGGGATTGGG + Intergenic
912548912 1:110471606-110471628 AGGGCCCTGCCCCGGGAAACAGG - Intergenic
913139384 1:115925571-115925593 GGGGCCCTGCCACAGGGCTGGGG - Intergenic
913971997 1:143423085-143423107 GGGGTCCTGCCCCAGGGAGGGGG + Intergenic
914066376 1:144248698-144248720 GGGGTCCTGCCCCAGGGAGGGGG + Intergenic
914112777 1:144717656-144717678 GGGGTCCTGCCCCAGGGAGGGGG - Intergenic
915610486 1:156988092-156988114 AGGGCACTTCCCCGGGCATCAGG - Intronic
919724479 1:200873061-200873083 AGGGCGCTGACCCCGGGCTGGGG - Exonic
920296100 1:204957835-204957857 AGGCCCCTGTCCCGGGGCTGGGG + Intronic
922722447 1:227905824-227905846 AGGGCCCTTCCCCAGGGAAGCGG - Intergenic
922755435 1:228094059-228094081 GCGGCACTGCCCCGGGCATGAGG + Intronic
923684031 1:236142129-236142151 AGCGCGCGGCCCCGGGGATGGGG + Intergenic
923684049 1:236142170-236142192 AGCGCGCGGCCCCTGGGATGGGG + Intergenic
923684081 1:236142246-236142268 AGCGCGCGGCCCCGGGGATGGGG + Intergenic
924188209 1:241519230-241519252 AGGGCAGCGCCCCGGGGCTGGGG + Intronic
924422864 1:243925403-243925425 TGGGCCCTGCACTGGGGAAGGGG + Intergenic
1063606357 10:7526282-7526304 AGGGCCCAGCAGCGGGGCTGAGG - Intergenic
1063949829 10:11212191-11212213 AGGGGCCTGCTGCAGGGATGTGG - Intronic
1065631243 10:27683190-27683212 CGGTCCGTGGCCCGGGGATGGGG + Intronic
1066022776 10:31319587-31319609 CCCGCCCTGCGCCGGGGATGCGG - Intronic
1067032290 10:42885971-42885993 AAGGCCCTGGCCCAGGGAGGGGG + Intergenic
1067069262 10:43120203-43120225 GGTGCCCAGTCCCGGGGATGAGG + Exonic
1067077393 10:43196021-43196043 AGGGCCCTGCTTTGGGGAGGGGG - Exonic
1068135537 10:52948795-52948817 AGGGGCCTGGCCCGGGCTTGGGG + Intergenic
1069797449 10:71062357-71062379 AGGGCCCAGCACCGGGGCTGAGG - Intergenic
1069854415 10:71431878-71431900 GGGGCCCTGCCCCGGGAGTTAGG + Intronic
1069918714 10:71803061-71803083 AGGGCCCTGGCGTGGGTATGTGG + Exonic
1070688538 10:78507894-78507916 AGGGTCCTGCCCCAGGGCTAGGG - Intergenic
1071989612 10:91088639-91088661 AAGGCCATGCCCCGGGCAGGGGG - Intergenic
1072241175 10:93496737-93496759 CCGGCCCGGCCCCGGGGCTGCGG - Exonic
1073062738 10:100742073-100742095 AGGGCCCTGACCCGGGGCCCAGG - Intronic
1073432229 10:103494100-103494122 AGGGCCCTGGGCCGGGGCCGGGG - Exonic
1074165287 10:110869697-110869719 AGGCCCCCGCCCAGGAGATGAGG + Intergenic
1075788008 10:125063051-125063073 AGGGCCCTGCCTCGCTGCTGGGG - Intronic
1076668370 10:132105422-132105444 AGGGGCAAGCCCGGGGGATGGGG + Intronic
1076919595 10:133444802-133444824 AGGGCTCTGCCCCAGGGCCGTGG - Intergenic
1077211032 11:1371041-1371063 AGGGCGCAGGGCCGGGGATGTGG - Intergenic
1077307860 11:1875951-1875973 GGGGTCCTGCCCCAGGGAGGGGG - Intronic
1077430434 11:2513484-2513506 TGGGCCATGCCCTGGGGAAGAGG - Intronic
1077489734 11:2855280-2855302 GGGGCCCCACCCCGGGGTTGTGG - Intergenic
1078907254 11:15699208-15699230 GGCACACTGCCCCGGGGATGGGG - Intergenic
1080855322 11:36106848-36106870 ATGTCCCTGCCCCGTGGATGCGG + Intronic
1083710160 11:64543010-64543032 AGGCCCCGGGCCCGGGGAGGCGG + Intergenic
1084673088 11:70619069-70619091 ATGGCCCTGCCCAGGGGAGGCGG + Intronic
1084780965 11:71407906-71407928 AGGGCCCAGCTCTGGGTATGGGG - Intergenic
1084926746 11:72519744-72519766 TGGGTCCTGCACCAGGGATGAGG - Intergenic
1085052121 11:73385206-73385228 AGGGCCCTGCCTAGGGGAGGGGG + Intronic
1089734605 11:120541075-120541097 GGGGCCCTGCCCCTGGACTGAGG + Intronic
1090173469 11:124625815-124625837 AGGGCCCAGCACTGGGGCTGAGG + Exonic
1090920664 11:131203592-131203614 AGGGCCCAGCCCGGGGAATCAGG - Intergenic
1091616380 12:2053684-2053706 AGGGACCGGCCCCGGGGCCGCGG - Intronic
1092195580 12:6547972-6547994 AGGGTCCTGCAGCAGGGATGAGG + Intronic
1092204954 12:6608949-6608971 AGATCCCTGACCTGGGGATGTGG - Intergenic
1096112805 12:49039292-49039314 AGGACCCTGGCCCCAGGATGGGG + Exonic
1096539233 12:52295529-52295551 AGGGCCCTGCAGAGGGCATGGGG - Intronic
1097181342 12:57173736-57173758 AGGGCCCAGGCCCGGGGACTGGG - Intronic
1098036047 12:66302798-66302820 AGGCGTCTGCCCGGGGGATGGGG + Intronic
1099083063 12:78210618-78210640 AGGGCCCTGACCCAGAGTTGTGG + Exonic
1102202914 12:111069978-111070000 AGGGCCCAGCTCCTGTGATGAGG + Intronic
1103563319 12:121803805-121803827 AAGGCCTTCCCCCGGGGAGGGGG + Intergenic
1103945320 12:124522970-124522992 AGGGGCCTGCCTCCTGGATGGGG + Intronic
1104904916 12:132207957-132207979 AGAGACCTGCCCCGGGTGTGGGG - Intronic
1104937712 12:132375363-132375385 AGGGCCCTGTCCTGAGGGTGAGG + Intergenic
1104995105 12:132649363-132649385 ATGGTCCTGCCACGGGGCTGGGG - Exonic
1106310386 13:28549079-28549101 AGAGCCCTTCCCCGATGATGTGG - Intergenic
1106376825 13:29197223-29197245 TGGGGCCTGTCCAGGGGATGGGG - Intronic
1107369527 13:39729171-39729193 GGGTCCCTGGCCCGGGGTTGGGG - Intronic
1109897739 13:68715827-68715849 AAGGCAGTGCCCAGGGGATGTGG + Intergenic
1112388800 13:98964114-98964136 ACGGCCCTGCCCCAGGGAGCTGG + Intronic
1113936183 13:113996266-113996288 GAGGCCCTGCCCCGGGGGAGCGG - Intronic
1114010640 14:18363536-18363558 AAGGCCTTGCCTCGGGTATGGGG - Intergenic
1117954572 14:61112698-61112720 AGGGCCCTGCTCAGGGAGTGGGG - Intergenic
1118747264 14:68783158-68783180 AGTGACTTGCCCAGGGGATGTGG - Intergenic
1121710984 14:96039234-96039256 CGGACCCCGCCCCGGGGGTGGGG + Intergenic
1122056169 14:99099635-99099657 AGGGCCAAGCCCCGAGGACGAGG + Intergenic
1122856868 14:104564137-104564159 AGGGCCTGACCCCGGGGGTGGGG - Intronic
1122961660 14:105096638-105096660 ACCGCCCTGCTCCCGGGATGGGG - Intergenic
1125927373 15:43573772-43573794 AGGGACCTAGCCTGGGGATGAGG - Intronic
1125940516 15:43673337-43673359 AGGGACCTAGCCTGGGGATGAGG - Intergenic
1126786199 15:52179632-52179654 AGGGCCCTGCTCCCGGGCGGTGG + Intronic
1128348976 15:66876492-66876514 ATGGCCCTGCCCCTGGGATGGGG + Intergenic
1128747273 15:70123393-70123415 AGGGACTTGCCTCAGGGATGTGG + Intergenic
1129460288 15:75697052-75697074 GGGGCCCTGGCCGGGGGAGGCGG - Intronic
1130542931 15:84835023-84835045 AGGCCCCAGCCCTGGGGCTGTGG + Intronic
1130553272 15:84905435-84905457 ATTGCCCTGCCCAGAGGATGGGG - Intronic
1130954992 15:88621392-88621414 AGGACCCTGCACCGGGGCGGCGG + Intronic
1132414813 15:101612570-101612592 AAGTCCCTGCCCCGGGGAGCAGG - Intergenic
1132607645 16:800231-800253 AAAGGCCTGCACCGGGGATGGGG - Intronic
1133045549 16:3086665-3086687 CCAGCCCTGCCCGGGGGATGAGG - Intergenic
1133218582 16:4308020-4308042 AAGGACCTGCCCCGGGGAGGAGG - Intergenic
1134005972 16:10818987-10819009 CAGGCCCGGCCCGGGGGATGTGG + Intergenic
1134006027 16:10819152-10819174 CAGGCCCGGCCCGGGGGATGTGG - Intergenic
1135536115 16:23295874-23295896 AGGGCCTTGACCTGGGGAAGAGG - Intronic
1135539756 16:23320844-23320866 AGGGCCCTGCCCCGTCCCTGAGG - Intronic
1137558648 16:49489208-49489230 AGGGCCCTGAGACGGAGATGTGG + Exonic
1139365150 16:66428156-66428178 TGGGCCCTGCCCCTGGGGAGCGG - Intronic
1139652711 16:68370682-68370704 AGGGCCCTGGCTCGGGGACAGGG - Intronic
1142746407 17:1961082-1961104 CTGGCCCTGTCCCGGGGATGGGG - Intronic
1142836856 17:2593856-2593878 TGGGCCCGGGCCCGGGGAGGGGG - Exonic
1143371875 17:6445290-6445312 AGGGCCCTGCGCGGAGGTTGAGG - Exonic
1143372627 17:6449795-6449817 GAGGCCCTGCCCCCAGGATGGGG - Intronic
1143490437 17:7282553-7282575 AGAGCCATGCCCAGGGGAGGAGG - Intronic
1145770081 17:27486589-27486611 AGGCAGCAGCCCCGGGGATGGGG + Intronic
1146283278 17:31559019-31559041 CCCGCACTGCCCCGGGGATGGGG - Intergenic
1146379901 17:32320902-32320924 AGGGCCCTGAGCAGGGGCTGAGG - Intronic
1146793602 17:35766425-35766447 GGGGTTCTGCCCCGGGGGTGGGG + Exonic
1147304889 17:39556432-39556454 AGGGCCCTGCCCTGGAGTAGAGG + Intronic
1147931507 17:43984161-43984183 GGGCGCCAGCCCCGGGGATGCGG + Intronic
1148093038 17:45034132-45034154 AGGGCCCTGGCCCTGGAAGGAGG + Intronic
1148739252 17:49882921-49882943 AGGACCCTGCCCAGGGGATTTGG - Intergenic
1148838394 17:50478754-50478776 AGGGCCCGGGCCCGGGGCTGCGG - Intergenic
1149781162 17:59397586-59397608 AGGGTCCTGGCGCGGGGAAGGGG + Exonic
1150291868 17:63987074-63987096 AGGGCCCTGCCCGGGCACTGTGG + Intergenic
1151712609 17:75815265-75815287 AGGGCACTGCCCCGGGGCAATGG - Intronic
1151819627 17:76490534-76490556 AGGGCACTGCCCTGGGGAACTGG + Intronic
1151876010 17:76868640-76868662 AGGGCGCGGGGCCGGGGATGAGG + Intronic
1152014610 17:77742192-77742214 AGGTCCATGGCCCGGGGTTGGGG + Intergenic
1152020962 17:77780026-77780048 GGGGACCTGTCCCGGGGCTGGGG - Intergenic
1152127627 17:78456798-78456820 AGGGTGGTGCCCCGGGTATGAGG - Intronic
1152224520 17:79086454-79086476 AGGTCCCGGTCCCGGGGCTGGGG + Exonic
1152366907 17:79861664-79861686 AGGGCCGAGCCCAGGGGAGGGGG - Intergenic
1152684515 17:81687490-81687512 AGGCCCCTGCCTGTGGGATGTGG - Intronic
1152701793 17:81823158-81823180 GTGGTCCTGCCCCTGGGATGGGG - Intronic
1152782386 17:82232045-82232067 AGGGCGCTGCACCGGGGGAGGGG - Intronic
1155473281 18:26212871-26212893 AGGGCCATTCCCCAGGGCTGAGG - Intergenic
1157596900 18:48869658-48869680 AGTGCCCTGCCTCGAGTATGTGG - Intergenic
1158552019 18:58444347-58444369 AGGGCCCTCCCACAGGGCTGAGG - Intergenic
1160043402 18:75365691-75365713 GGGGCCCTCCCCCGGAGGTGGGG - Intergenic
1160680099 19:408486-408508 AGGGCCCTGCCGGCGGGGTGGGG + Intronic
1160788313 19:912080-912102 GGGGCGCGGCCCCGGGGAGGTGG + Intronic
1160788385 19:912228-912250 GGGGCGCGGCCCCGGGGAGGTGG + Intronic
1160860166 19:1234315-1234337 AGGGCCTTCCCCGGGGGCTGTGG + Exonic
1161288772 19:3481879-3481901 TGGGCCCTGCCCGGGCGAAGGGG + Intergenic
1161294998 19:3515002-3515024 AGTGCCCTGCCAAGGGGATGGGG + Intronic
1161343242 19:3753987-3754009 AGGGACCCGCCCCAGGGATGCGG - Intronic
1161569613 19:5023390-5023412 CGGCCCCAGCCCCGGGCATGTGG - Intronic
1161849705 19:6731999-6732021 AGGACCCTGCCCCCGGGCTGAGG - Intronic
1162021431 19:7870142-7870164 AGGGGCCTGCCCAGGGAATGAGG + Exonic
1162021565 19:7870550-7870572 AGGGGCCTGCACTGGGGGTGAGG + Exonic
1162422264 19:10572573-10572595 AGGGCCATGACCCGGGACTGAGG + Intergenic
1162672196 19:12266536-12266558 AGGCCCCTCCCCCTGGGGTGGGG + Intronic
1162718452 19:12648024-12648046 CGGGGACTGCCCAGGGGATGGGG + Intronic
1162921704 19:13906689-13906711 GGGGCCCTGCCCCGGGTTCGGGG + Intronic
1163023429 19:14495874-14495896 AGGCCCCTTCCCAGGGGAAGCGG - Intronic
1163035094 19:14565342-14565364 AGGGACCAGCCCCTAGGATGGGG + Intronic
1163446748 19:17351560-17351582 GGGGCCCTGAGCCGGGGGTGAGG - Exonic
1163609387 19:18293012-18293034 GGGGCCCTGAACCGGGGATGGGG + Intergenic
1163670099 19:18622632-18622654 TGAGCTCTGCCCAGGGGATGAGG - Intergenic
1164159509 19:22617407-22617429 GGGGGCATGCCCCTGGGATGTGG + Intergenic
1164618515 19:29680573-29680595 TGGGCTCAGCCCCTGGGATGGGG + Intergenic
1164686013 19:30167342-30167364 AGGGCCCAGCCCGGGGGACCAGG - Intergenic
1164826200 19:31286700-31286722 AGCGCCCTGTCCCCGGAATGAGG + Intronic
1165369523 19:35395860-35395882 AGTGCCCATCCCCGGGGCTGCGG + Intergenic
1165418633 19:35711246-35711268 AGGGACTAGCCCCAGGGATGAGG - Intronic
1165707314 19:37985833-37985855 AGGGCCCTTACCCAGGGATGCGG + Intronic
1166072414 19:40394920-40394942 AGGGCCATGACGCGGGGCTGAGG - Exonic
1166234194 19:41443887-41443909 AGGACCCTGCCCAGGCGCTGTGG + Intronic
1166253473 19:41586574-41586596 AGCCCCCAGCCCTGGGGATGGGG + Intronic
1166410551 19:42553412-42553434 AGCTCCCAGCCCTGGGGATGGGG - Intronic
1166520216 19:43475179-43475201 AAGGCCCTGCCCGGGGCAGGAGG - Exonic
1166775250 19:45308277-45308299 AGGGCCCTGCCCCCCGGACCTGG - Intronic
1166971939 19:46574704-46574726 AGGTCCCTCCCCCAGGCATGTGG - Intronic
1168291767 19:55360665-55360687 TGGGCCCTGCCCCGGGTATAAGG + Intronic
924962590 2:46944-46966 AGGCACCTGCCCGGGGGAGGTGG - Intergenic
925541988 2:4976538-4976560 AGAGACCTGCCCGGGGGAAGGGG - Intergenic
925614835 2:5735163-5735185 AGTGCCCTGCCACGGGCTTGGGG + Intergenic
925971793 2:9111272-9111294 AGGGCCAGGCCCCCGGGGTGGGG - Intergenic
926058354 2:9789807-9789829 AGGACCCTCACCTGGGGATGTGG - Intergenic
926109612 2:10173562-10173584 AGAGCCCTGCCCAGGGGTGGTGG - Intronic
926121006 2:10241130-10241152 AGGGCCCTGCACCCAGCATGGGG + Intergenic
927708211 2:25310172-25310194 AGGGGCCTGGCCTGGGGCTGTGG + Intronic
927870358 2:26619240-26619262 AGGGCCCTCCCCGGGGGGTGAGG + Intronic
930095187 2:47561221-47561243 AGGGCTCTGCTCCGGGTGTGGGG + Intronic
930774549 2:55159284-55159306 AGGTCCCTGCCCAGTGGAAGTGG - Intergenic
931121525 2:59225571-59225593 AGGGCCCTGCCTCTGGGGTTGGG - Intergenic
932573567 2:72950862-72950884 AGGGGCCTTCTCCGGGGATAAGG + Intronic
932699907 2:73985217-73985239 GGGGCCCGGCCCGGGGGAGGGGG + Intergenic
934176689 2:89584017-89584039 GGGGTCCTGCCCCAGGGAGGGGG + Intergenic
934286998 2:91658378-91658400 GGGGTCCTGCCCCAGGGAGGGGG + Intergenic
934758507 2:96840578-96840600 AGGGACCTGGCCCTGGGAAGGGG - Intronic
936048202 2:109202813-109202835 TGGGCCCTTTCCCGGGAATGGGG - Intronic
937156721 2:119725025-119725047 AGGGACGTCCCCCGGGGATGGGG - Intergenic
937349953 2:121154527-121154549 AGGGTCCTGGCCCTGGGCTGGGG - Intergenic
937909452 2:127068496-127068518 ACGGCCCTGCCCGGAGGACGGGG + Intronic
938368875 2:130756411-130756433 TTGGTCCTGCCCCGCGGATGTGG + Intronic
945204763 2:207319839-207319861 AGGGTACTGCCCAGGGGATGTGG + Intergenic
945974451 2:216259462-216259484 AGGGCCCTGCTCAGGGGCAGGGG + Exonic
946190132 2:218003576-218003598 ATGGCCCTGCCCCCAGGCTGTGG + Intergenic
946416774 2:219543811-219543833 AGGGCCCCGCCCCCGGGGTGGGG + Exonic
947370446 2:229440359-229440381 AGGGCACTGCCCAGGGCGTGAGG - Intronic
947523364 2:230864860-230864882 GGGGCCCTCCCGCGGGGACGGGG + Intronic
947729238 2:232418980-232419002 AGGGCCACGCCCCGGGTCTGCGG + Intergenic
948834777 2:240620638-240620660 AGGGCCCTGCACTTGGGCTGTGG + Intronic
948908587 2:240991747-240991769 AGGGCCTGGCCCCGGGGGTCTGG - Intronic
1168777793 20:462398-462420 AGGGCCATGCCCCGGGGCCCCGG + Exonic
1168784027 20:521966-521988 AGGCCCATGGCCCGGGGATTGGG - Intronic
1170602157 20:17849310-17849332 AGGCCCCTGCCCCGGGCCTCAGG + Intergenic
1172101144 20:32484316-32484338 GGGGCCCTGCCGTGGGGGTGGGG - Intronic
1172213202 20:33215400-33215422 AGGGCCCTGCTCAGGGGCTGGGG - Intergenic
1172689504 20:36780553-36780575 AGTGCCCTGGCCCTGGGGTGGGG - Exonic
1172760392 20:37317301-37317323 AGGGCCCTGCCCCGGGGATGAGG + Intergenic
1172949435 20:38713280-38713302 AGGGCCTTGACCAGGGGAGGCGG - Intergenic
1173135211 20:40433330-40433352 AGCACCCTGCCCTGGGGAGGAGG + Intergenic
1175240988 20:57548714-57548736 AAGGCCCTGAACTGGGGATGAGG + Intergenic
1175277744 20:57783453-57783475 AGGGCCATGGCCAGGGGCTGAGG + Intergenic
1175321940 20:58094434-58094456 ACTGCTCTGCCCTGGGGATGTGG + Intergenic
1175819092 20:61898853-61898875 AGCTCCATGCCCCTGGGATGGGG - Intronic
1175931304 20:62495090-62495112 AGGGCCCTGCCCCGGGACGCTGG + Intergenic
1176110148 20:63407406-63407428 AGGGCCCGTCCCAGGAGATGTGG + Intronic
1177228973 21:18294355-18294377 AGGGGCCTGGCCCTGGGTTGTGG - Exonic
1178457693 21:32771271-32771293 GGGGGCCTGCGTCGGGGATGCGG + Intronic
1179187219 21:39094130-39094152 GGGGCCCTGTCCTGGGGAGGAGG + Intergenic
1179833321 21:44012111-44012133 TGGGCCCTGCGCCGGAGCTGAGG - Intergenic
1179963046 21:44781672-44781694 AGGGCCCTGCTCTGGGGGTGAGG - Intronic
1180051883 21:45335282-45335304 AGGGCACTGGCCCGGCGAGGGGG - Intergenic
1180066380 21:45414606-45414628 ATGGCCATGCTCCGGGCATGTGG + Intronic
1180157950 21:45987076-45987098 AGGCCCCTGCCCAGGAGACGGGG + Intronic
1180435133 22:15294339-15294361 AAGGCCTTGCCTCGGGTATGGGG - Intergenic
1181081315 22:20417703-20417725 TGGGGCCTGCTACGGGGATGTGG - Intergenic
1181715378 22:24723453-24723475 GGGACCCTTCCCCTGGGATGTGG - Intronic
1182550960 22:31100515-31100537 AGGGCTGTGCCCCGGGGAGAGGG - Intronic
1183362381 22:37389455-37389477 AGGTCTCGGCCCAGGGGATGGGG - Intronic
1184319110 22:43725487-43725509 AGGGCTCTGCCCCTGTGAAGGGG - Intronic
1184644844 22:45890113-45890135 AGGACCCTGCCTCTGGGGTGGGG - Intergenic
1185015373 22:48339636-48339658 TGGGCCCTGCCCCTGAGCTGGGG + Intergenic
1185054315 22:48570069-48570091 AGGGCCCTGCCAGGGGAGTGTGG - Intronic
1185119057 22:48954924-48954946 AGGGCCCAGCTTGGGGGATGAGG - Intergenic
1185409617 22:50674845-50674867 GGGGCCCCGCCCTGGCGATGGGG - Intergenic
950084660 3:10248751-10248773 AGCGCCCGGCCCCGGGGCCGCGG + Exonic
950451512 3:13068133-13068155 AGGGTCCTGCCCCGGGGCTGGGG + Intronic
953577046 3:44121159-44121181 AGGGGCCTGGCCCGGGGCTCAGG - Intergenic
953726999 3:45408305-45408327 AGAGCCCTGGCCAGGGGGTGAGG - Intronic
953837858 3:46362669-46362691 AGGGCCCTGCCTAGAGGAGGGGG + Intergenic
953916163 3:46922424-46922446 AGGGGGCTGCCCTGGGGAAGAGG + Intronic
954124762 3:48521776-48521798 AGGCACCTGCCCTGGGGATGGGG - Intronic
954367644 3:50154952-50154974 CGGGTCCCGCCCCGGGGGTGGGG + Intergenic
954625814 3:52021377-52021399 AGGACCCTCCCCAGGGGCTGAGG - Intergenic
954812577 3:53257067-53257089 AGAGCCCTGCACAGGGGATGGGG + Intergenic
955696481 3:61642197-61642219 CGGGCCCTGACCCCGGGCTGTGG + Intronic
958816175 3:98918393-98918415 AGGCCCCTGCACAGGGGCTGAGG + Intergenic
964505661 3:157396087-157396109 TGGGGCCTGCAGCGGGGATGGGG - Intronic
966762081 3:183427796-183427818 AGCGCGCTGCCCCGGGGCAGCGG + Intronic
967780722 3:193436811-193436833 CGCGCCCGGCCCCGGGGATCAGG - Intronic
968074706 3:195810019-195810041 ACGGCCCTGCCCTGCAGATGTGG - Intronic
968547460 4:1206266-1206288 AGGGCCCTGCCAAGGGTCTGCGG + Intronic
968957164 4:3725330-3725352 AGGGCCAAGCGCCGGGGCTGGGG + Intergenic
969590973 4:8121780-8121802 AGGGCACTGTCCAGTGGATGGGG + Intronic
970585732 4:17512244-17512266 CAGGCCCTGCCCCTGGGACGGGG + Intergenic
970666384 4:18342354-18342376 AGGCCGCTGACCCTGGGATGGGG + Intergenic
975131939 4:70839781-70839803 GGGGCGCTGCTCCGGGGCTGCGG - Exonic
976089338 4:81439529-81439551 TGGGCTCTGCCCCAGGGAGGAGG - Intronic
983157510 4:164369094-164369116 AGTGGGCTGCTCCGGGGATGAGG + Intronic
983533419 4:168833067-168833089 CCGGCCCCGCCCCGGGGCTGGGG + Intronic
984336108 4:178393535-178393557 AGGGGCCTGCCAGGGGGTTGGGG - Intergenic
985125839 4:186693557-186693579 AGGGCCCTGCTCCCAGGAGGTGG - Intronic
985497502 5:218064-218086 CGGGCCCTGTTCCGGGGAGGTGG - Intronic
985589158 5:755820-755842 AGGGCCCGGCCCTGTGGCTGCGG - Intronic
985603837 5:848336-848358 AGGGCCCGGCCCTGTGGCTGCGG - Intronic
985670565 5:1204520-1204542 GGGGCCCTGCCGTGGGGATGTGG - Intronic
985718891 5:1478605-1478627 AGGGCCTTGGCCCGGGCCTGAGG - Intronic
985754504 5:1705012-1705034 ATGGCCCTGCCCAGGAGAGGTGG + Intergenic
988482178 5:31639654-31639676 AGGGCGCAGCCCAGGGGAGGGGG + Intronic
990002390 5:50909789-50909811 AGGCTGCTGCCCCGGGGTTGGGG - Intergenic
990557614 5:56951792-56951814 TGAGCCCTGCCCCAGGGACGAGG - Intronic
996530261 5:124520961-124520983 CTGGCCCTACCCCAGGGATGTGG - Intergenic
998463766 5:142326856-142326878 AGGGTCCTGCACCGGGTATATGG + Intergenic
1000969729 5:167700378-167700400 AGGCCCCTGCCCAAGGGTTGTGG - Intronic
1001493686 5:172173251-172173273 AGGGCCCTGATACGGGGTTGGGG - Intronic
1001642566 5:173254939-173254961 AGGGCCAGCCCCGGGGGATGGGG + Intergenic
1002082084 5:176743298-176743320 TCGTCCCTGCCCCGGGGGTGCGG + Intergenic
1002082163 5:176743577-176743599 AGGGGCCAGCCCCGGGGGTGCGG - Intergenic
1002645126 5:180649181-180649203 AGGGCCCGGCTCCGAGGACGCGG + Intronic
1004373938 6:15075843-15075865 AGGGCACTGCTCCCGGCATGAGG + Intergenic
1006331168 6:33392016-33392038 GGTGTCCTGCCCTGGGGATGGGG + Intronic
1006386364 6:33733283-33733305 AGGGGGCTGGCCCTGGGATGGGG + Intronic
1006414119 6:33893264-33893286 AGGGCCCTCGGCCGGGGACGCGG + Intergenic
1006665294 6:35688936-35688958 CGGGCGCTGCCCCGGGGATTCGG - Intronic
1006743801 6:36327214-36327236 AAGAACCTGCCCCTGGGATGTGG - Intronic
1006751847 6:36383202-36383224 ATGGCCATGGACCGGGGATGGGG + Intronic
1006835655 6:36997469-36997491 AGGGCCCAGGCCCTGGGTTGGGG + Intergenic
1007459888 6:42010318-42010340 AGGGCAGTGCCCCGGGGCAGGGG - Intronic
1007503009 6:42312982-42313004 AGGGCACTGCCCCAGGGTCGAGG - Intronic
1007730266 6:43941266-43941288 AGGGCCCTTCTCCTGGGATCTGG + Intergenic
1007978494 6:46126131-46126153 AGGAGTCTGCCCCGTGGATGAGG + Intergenic
1008374662 6:50778029-50778051 AGGGCCATGTCCTGGGGGTGAGG + Intergenic
1008475383 6:51930721-51930743 AGGGCACTGCCCAGCGAATGAGG - Intronic
1008920764 6:56843027-56843049 TGGTCCCTGCCCTGGGGCTGCGG - Intronic
1012474852 6:99607221-99607243 AGTGCCCTGACCCGGGAAAGGGG + Intronic
1015519340 6:134115111-134115133 GGGGCCCTGCCGCGGTGGTGAGG + Intergenic
1016885669 6:148957213-148957235 AGGGCCCAGGCCCTGGTATGTGG - Intronic
1017179040 6:151532963-151532985 AGGGCCCTGCGGCAGGGATCTGG - Intronic
1018214970 6:161518113-161518135 AGGCCACTGGCCTGGGGATGGGG + Intronic
1018677939 6:166238999-166239021 ATGTCCCTGCCCCTGAGATGTGG + Intergenic
1018696972 6:166397896-166397918 AGGGACCTGCACAGGGGCTGAGG + Intergenic
1018754466 6:166837412-166837434 AAGGCCCTGCTTCGGGGAAGAGG - Intronic
1018942652 6:168319628-168319650 GGGACCCTGCCCGGGAGATGTGG - Exonic
1019354086 7:569948-569970 AGAGCCCAGCCCCGGGGTTCTGG + Intronic
1019354156 7:570233-570255 AGGGCCCTGCCACGAGCCTGCGG - Intronic
1019476432 7:1246838-1246860 CGGGCCCTGCCCTGGGGTCGGGG - Intergenic
1019835488 7:3378929-3378951 AGGGGTCTGCTCCGGGGAAGGGG - Intronic
1021163103 7:17299349-17299371 AGCGCCCAGCCCCCGCGATGAGG - Intronic
1021716834 7:23469243-23469265 CGGGCCCTGGCGCGGGGCTGCGG - Intronic
1022717151 7:32908927-32908949 TGGGAACTGCCCTGGGGATGGGG + Intergenic
1022973053 7:35534984-35535006 AGAGCCCTTCCCAGGGGATGTGG + Intergenic
1023877168 7:44293101-44293123 AGGGCGCTGCCCCTGGGAGAGGG - Intronic
1023999177 7:45179733-45179755 AGGGCCCTTGCCAGGGGCTGAGG + Intronic
1025739468 7:64183684-64183706 AGGGCCCTGTCCCCAGGAGGGGG + Intronic
1026959319 7:74398570-74398592 AGGGCCCAGCCCTGGGCAAGGGG + Intronic
1027055825 7:75048653-75048675 AGGGCGCTCCCTGGGGGATGAGG + Intronic
1028645979 7:93097331-93097353 AGGGAGCTGCCACAGGGATGGGG + Intergenic
1029438530 7:100575251-100575273 AGGGCACTGCCCGGGGGCTGCGG - Exonic
1030614854 7:111728715-111728737 AGAGCCCTGCTCCGGGGAGAAGG + Exonic
1032128781 7:129212646-129212668 AGGGCCCTGTCCCTGGGGTGAGG - Exonic
1034430881 7:151040663-151040685 GGGTCCCTGGGCCGGGGATGAGG + Intronic
1034449088 7:151127907-151127929 AGGAGCCTGCCCCGGGGACAGGG - Intronic
1034943135 7:155244904-155244926 AGGGTGCTGCGCTGGGGATGGGG - Intergenic
1034971774 7:155423863-155423885 AGGGAGCTGCCCAGGTGATGAGG + Intergenic
1035705507 8:1671518-1671540 AGGGTCCTGTCCCGGGGTGGGGG + Intronic
1036454058 8:8892926-8892948 CGGGGCCTGCCCCGGGGCCGGGG - Exonic
1036755555 8:11468600-11468622 AGGGCTCAGCACCGGGGCTGTGG - Intronic
1037803671 8:22048341-22048363 AGGGTCCTCCCTCGGGGATCTGG - Exonic
1038147701 8:24913685-24913707 AGGGCCCCGCCCCGTGGAGGCGG - Exonic
1038494168 8:27990023-27990045 AGGGCGCTGCCCCTGGGGAGTGG + Intronic
1038612421 8:29068909-29068931 AGGGCCCGGCCCCTGGGGGGAGG - Exonic
1041005657 8:53495014-53495036 AGGACCCTGGCCCAGGGAGGTGG - Intergenic
1041713491 8:60913596-60913618 AGGCCCCTGTCACCGGGATGGGG + Intergenic
1042068760 8:64907230-64907252 AGGCCACGGCCCAGGGGATGGGG + Intergenic
1043826054 8:84929657-84929679 AGAGCCCTGACCAGGGGATTTGG - Intergenic
1044115340 8:88327975-88327997 GGGTGCCTGCCTCGGGGATGCGG - Intronic
1049369965 8:142259707-142259729 AGGGGCCTGCGCCGGTGCTGGGG - Intronic
1049487446 8:142873976-142873998 GGGGCCCTGGCCAGGGGAAGAGG + Exonic
1049761018 8:144332074-144332096 AGGGGCCTGCCTCGGAGAGGCGG + Exonic
1049790881 8:144472288-144472310 AGGGCCCTGGGCCAGGGGTGGGG - Intronic
1052872740 9:33524003-33524025 AGGGACCGTCCGCGGGGATGGGG - Intergenic
1053050854 9:34959126-34959148 AGGGCCCTAAGCCGAGGATGAGG + Intronic
1053470105 9:38340256-38340278 AAGGCCATGCCAGGGGGATGGGG - Intergenic
1057260020 9:93577783-93577805 AGGGACCTGCCCTAGGCATGGGG - Intronic
1057896951 9:98916813-98916835 GGGGCCCTGGCCCTGGGAGGCGG + Intergenic
1059434971 9:114270634-114270656 AGGGTCCTGCCCCAGGGAGGGGG + Intronic
1059512993 9:114866417-114866439 AGGGCAATGCCCAGGGGCTGTGG + Intergenic
1060413615 9:123415734-123415756 AGGGCCCTGCTGCAGGGATGCGG + Intronic
1060789799 9:126478402-126478424 CAGGCCCTGCCCCTGGGCTGGGG + Intronic
1060814637 9:126628152-126628174 AGGGCCAAGCCCAGGGTATGCGG - Intronic
1060822627 9:126670187-126670209 AGGGCTCTGCCCCTTGGAGGGGG - Intronic
1060894491 9:127209003-127209025 AGGGCCCTGCTCTGGGAAGGGGG + Intronic
1060939316 9:127534589-127534611 CGGGCCCTGCCTCAGTGATGGGG + Intronic
1061582387 9:131545913-131545935 CGGGCCCAGGCCCGGGGCTGTGG + Intergenic
1061693929 9:132356676-132356698 AGAACCCTGGCCCGAGGATGAGG + Intergenic
1061912855 9:133734102-133734124 AGAGCCCTACCCGGGGCATGGGG - Exonic
1061994196 9:134175645-134175667 TGGGCCTTGCCCTGGGGAGGTGG + Intergenic
1062136154 9:134929539-134929561 GGGTCCCTGCCCAGGGGTTGGGG - Intergenic
1062435910 9:136546480-136546502 AGAGCCCTGCCCCGGGCCCGGGG - Intergenic
1062461807 9:136665534-136665556 AGCGCCCTGCCGCGGGGACTCGG + Intronic
1062695722 9:137875403-137875425 AGTGCCCTGTCCCGGAGCTGAGG - Intergenic
1185894081 X:3843221-3843243 AGGGCCCTGCCCCGCCGCTGCGG - Intronic
1185899199 X:3881645-3881667 AGGGCCCTGCCCCGCCGCTGCGG - Intergenic
1185904316 X:3920074-3920096 AGGGCCCTGCCCCGCCGCTGCGG - Intergenic
1187521872 X:20021176-20021198 AGGGCCCAGCCCCCAGGCTGTGG - Intronic
1187960453 X:24562443-24562465 AGGGCTCTGCTTCGGGGATAAGG + Exonic
1190322324 X:49186430-49186452 AGGGCCCGCCCCCGGGCATGTGG + Intronic
1200068148 X:153514785-153514807 AGGGCCCAGGCCTGGGAATGAGG - Intergenic
1200238851 X:154483184-154483206 AGGGCCCTTCACCGGGCAGGGGG + Intergenic