ID: 1172768111

View in Genome Browser
Species Human (GRCh38)
Location 20:37361763-37361785
Sequence CAGGGCAGGAGTGCTGCTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 468
Summary {0: 1, 1: 1, 2: 7, 3: 28, 4: 431}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172768104_1172768111 0 Left 1172768104 20:37361740-37361762 CCTCTCCTGACACTGAGCAGGGG 0: 1
1: 1
2: 3
3: 29
4: 261
Right 1172768111 20:37361763-37361785 CAGGGCAGGAGTGCTGCTGAGGG 0: 1
1: 1
2: 7
3: 28
4: 431
1172768107_1172768111 -5 Left 1172768107 20:37361745-37361767 CCTGACACTGAGCAGGGGCAGGG 0: 1
1: 0
2: 1
3: 42
4: 405
Right 1172768111 20:37361763-37361785 CAGGGCAGGAGTGCTGCTGAGGG 0: 1
1: 1
2: 7
3: 28
4: 431
1172768100_1172768111 22 Left 1172768100 20:37361718-37361740 CCACCTCAGTGTTCTCTGTGATC 0: 1
1: 0
2: 1
3: 29
4: 262
Right 1172768111 20:37361763-37361785 CAGGGCAGGAGTGCTGCTGAGGG 0: 1
1: 1
2: 7
3: 28
4: 431
1172768101_1172768111 19 Left 1172768101 20:37361721-37361743 CCTCAGTGTTCTCTGTGATCCTC 0: 1
1: 1
2: 1
3: 39
4: 307
Right 1172768111 20:37361763-37361785 CAGGGCAGGAGTGCTGCTGAGGG 0: 1
1: 1
2: 7
3: 28
4: 431

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172768111 Original CRISPR CAGGGCAGGAGTGCTGCTGA GGG Intronic
900253528 1:1684349-1684371 CAGGGCAGCGTTTCTGCTGAAGG + Intronic
900282025 1:1876100-1876122 CAGGGCCCCAGTGCTTCTGAAGG - Intronic
900562042 1:3312026-3312048 CAGCCCAGGAGTGCGGCTCATGG + Intronic
900920687 1:5668234-5668256 CAGCACTGGAGTGCAGCTGAGGG - Intergenic
900947557 1:5839780-5839802 CAGGGCAGGAGTGCTGTGCTGGG - Intergenic
901190775 1:7408562-7408584 CAGGGCAGAGGTGCTGCCCAGGG - Intronic
901868511 1:12123677-12123699 CAAGGCAGGAGTGATGAAGATGG - Intronic
901911342 1:12460953-12460975 CAGGTCAGCAGTTCTGCTGTGGG + Intronic
902400243 1:16153461-16153483 CTGAGCTGGGGTGCTGCTGATGG - Intronic
902454322 1:16521108-16521130 CAGGGCAGGGATGGTGGTGAGGG + Intergenic
902498132 1:16889209-16889231 CAGGGCAGGGATGGTGGTGAGGG - Intronic
903677447 1:25073165-25073187 CGAGGCAGGAATGCTGCTTAAGG + Intergenic
904441740 1:30536201-30536223 CATGGCAGGAGGTCTGCTGCAGG - Intergenic
904514732 1:31045514-31045536 CAAGGCAGGAGGACTGCTGGAGG + Intronic
904603824 1:31688394-31688416 CAGGGGAGGAGTGGTGCGGGCGG - Intronic
905029396 1:34871440-34871462 GAAGCCAGGAGGGCTGCTGAGGG - Intronic
905393214 1:37651234-37651256 CTGGGCTGGAGAGCTGCCGATGG - Intergenic
905656979 1:39691637-39691659 CAGGGCAGGGGTGCAGATGGGGG - Exonic
905734480 1:40316263-40316285 CCGGGCAGCTGTGCTGCCGAAGG - Intronic
906776756 1:48536749-48536771 CAGAGCAGGTGTGCTTCTGTAGG - Intronic
907075139 1:51571431-51571453 CAGGGCAGGAGGACTGCTTGAGG + Intergenic
907454327 1:54565445-54565467 CCTGGCAGGAGTGCAGCAGAGGG - Intronic
908250121 1:62259042-62259064 CAGGGCAGGTGGGGTCCTGAAGG + Intronic
910066007 1:83151529-83151551 AAGGGCAAGAGGGCCGCTGAGGG - Intergenic
910970965 1:92855464-92855486 CAGGGCAGGAGGACTGCTTGAGG + Intronic
911103424 1:94111534-94111556 CACGGCAGCATTCCTGCTGAGGG + Exonic
912488890 1:110050333-110050355 CAGGACAGAAATGCTGCAGAGGG - Exonic
913116564 1:115702792-115702814 GAGGGCAGGGGTCCTGCTCAAGG - Intronic
913280496 1:117180839-117180861 AAGGGCAGGAGCACTGCTCAGGG + Intronic
913655111 1:120952770-120952792 CAGGGCAGGGATGGTGGTGAGGG + Intergenic
914006463 1:143736444-143736466 CAGGGCAGGGATGGTGGTGAGGG + Intergenic
914095371 1:144540143-144540165 CAGGGCAGGGATGGTGGTGAGGG + Intergenic
914303155 1:146393753-146393775 CAGGGCAGGGATGGTGGTGAGGG - Intergenic
914480384 1:148060595-148060617 CAGGGCAGGGATGATGGTGAGGG + Intergenic
914645296 1:149646930-149646952 CAGGGCAGGGATGGTGGTGAGGG + Intergenic
914843071 1:151264270-151264292 CAGGGGAGGAGGATTGCTGAAGG + Intronic
915970796 1:160353701-160353723 CAGAGCAGGGATGATGCTGAAGG - Intronic
916292987 1:163187085-163187107 GATGGCTGGAGTGCAGCTGAGGG - Intronic
916556517 1:165898573-165898595 CAGGGATGCAGTGCTGCCGAGGG + Intronic
916558423 1:165912203-165912225 CAGGGCAGGAGGACTGCTTGAGG + Intergenic
918708329 1:187696331-187696353 CAGGGCAGGTGTGTTGGGGAGGG + Intergenic
920343066 1:205287717-205287739 CAGGGCTGGGGAGTTGCTGAGGG + Intergenic
920786472 1:209047084-209047106 CTGGGCCTGAGAGCTGCTGAAGG + Intergenic
921701352 1:218272273-218272295 CAGGGCAAGTGTGCTCTTGAGGG - Intergenic
922414379 1:225407141-225407163 CAGGTCAGGAGGGCAGCAGAGGG - Intronic
922794430 1:228333127-228333149 CAGGGCGGGAGGGGTGCTGAGGG - Intronic
923630306 1:235645255-235645277 CAGGGCAGGGAGGCTGCTGAGGG - Intronic
923734586 1:236592841-236592863 CGGGGCAGGAGAACTGCTTAAGG + Intronic
924018298 1:239752208-239752230 CAGGTCAGGAGTGGACCTGATGG - Intronic
924629606 1:245724325-245724347 CAGAGCAGGTGTGCTGCAGTGGG - Intergenic
1062861287 10:812410-812432 CAGGGCATCAGTGCTGATGTGGG - Exonic
1062900141 10:1137957-1137979 CAGGTCAGATGTGCTGGTGAAGG - Intergenic
1063454054 10:6170750-6170772 CAGAGCAGGAAAGCTGCTGGGGG + Intronic
1063543999 10:6962274-6962296 CAGGGCAGGAGTGCTTCTGCTGG - Intergenic
1064192803 10:13222267-13222289 CAGGGCAGGGGTTCGGCTGATGG - Intronic
1064348469 10:14554596-14554618 CATGCCAGGAGTTCTGCTTAAGG + Intronic
1064978323 10:21141921-21141943 TAGAACAGGAGTTCTGCTGAAGG - Intronic
1065639498 10:27767446-27767468 CAGGCCATCAGTGCTGTTGATGG - Intergenic
1065697434 10:28392625-28392647 CAAGGCAGGAGGACTGCTTAAGG + Intergenic
1067041074 10:42953547-42953569 CAAGGCAGGAGGCCTCCTGAGGG + Intergenic
1067279726 10:44862157-44862179 CAGAGAGAGAGTGCTGCTGATGG - Intergenic
1067448939 10:46369374-46369396 CAGGGCATGAGTCCTGGTGCTGG + Intronic
1067588430 10:47491391-47491413 CAGGGCATGAGTCCTGGTGCTGG - Intronic
1067635556 10:47999482-47999504 CAGGGCATGAGTCCTGGTGCTGG - Intergenic
1067693456 10:48519277-48519299 CTGGGCAGGAATGCTGTTGCTGG - Intronic
1067877973 10:50020921-50020943 CAGGGCATGAGTCCTGGTGCTGG + Intergenic
1069608045 10:69752614-69752636 CGGGGGAGAAGTGCTGCAGAAGG + Intergenic
1069899199 10:71697206-71697228 GAGGGCAGGAGACCTGGTGAAGG - Intronic
1070095662 10:73335906-73335928 CAAGGCAGGAGTACTGCTTGAGG + Intronic
1070132114 10:73663489-73663511 CAGGGCATGAGTCCTGGTGCTGG - Intronic
1070924151 10:80207214-80207236 CTGGGCAGGTGTGCTGGTGCCGG + Intergenic
1071335255 10:84595120-84595142 CAGGAGATGAGTTCTGCTGAGGG + Intergenic
1071609569 10:87020586-87020608 CAGGGCATGAGTCCTGGTGCTGG + Intronic
1072190930 10:93075467-93075489 CCGGTCAGGAGAGCTGCGGAAGG + Intronic
1072298381 10:94035064-94035086 CAGGACAGGCATGCTGGTGAGGG - Intronic
1072520722 10:96227620-96227642 CAAGGCAGGAATGGTCCTGACGG - Intronic
1072770379 10:98132907-98132929 TAGGGAATGGGTGCTGCTGATGG + Intergenic
1075132483 10:119751861-119751883 CAGGGCAGGGGAACTGCTGGAGG - Intronic
1075176010 10:120161628-120161650 CAGGGCAGGAGTGACTCAGAAGG + Intergenic
1076659825 10:132048128-132048150 CAGAGCAGGTGTGATGTTGAGGG + Intergenic
1077076353 11:704159-704181 CAGGGCAGGAGAACTGGAGATGG - Intronic
1077244314 11:1528738-1528760 GAGTCCAGGAGTGGTGCTGAGGG - Intergenic
1077330103 11:1980434-1980456 CAGGGCAGCTGTGCTCCAGAGGG - Intronic
1077556755 11:3229764-3229786 GAGGGCTGGAGTCCTGCTGTAGG - Intronic
1077603479 11:3590626-3590648 CAGGGCAGGGGTTCTCCTTAGGG - Intergenic
1079496837 11:21053521-21053543 CAGGGCAGGAGCCCTCCTCAGGG + Intronic
1079520536 11:21321278-21321300 CCTGGCAGGATTACTGCTGAGGG - Intronic
1083296850 11:61719637-61719659 CAGGGCAGGAGGAAGGCTGAAGG - Intronic
1083321157 11:61847893-61847915 CAGATGAGGCGTGCTGCTGAGGG - Intronic
1083488187 11:62996483-62996505 CAAGGCTGGACTGCTGCTGGAGG + Intronic
1084094580 11:66902659-66902681 CAGGGCAAGAGTGATGGTGGAGG - Intronic
1084424528 11:69077181-69077203 CATGGCAGGAGGGCAGGTGAAGG - Intronic
1084424576 11:69077339-69077361 CATGGCAGGAGGGCAGGTGAAGG - Intronic
1084441033 11:69173481-69173503 CAAGGCAGGACTGATGGTGAGGG + Intergenic
1084447475 11:69212276-69212298 CAGGGCAGGAGGGCGGCACATGG - Intergenic
1084928508 11:72534723-72534745 CATGGCAAGAGTGCAGCTGAGGG - Intergenic
1085274066 11:75287083-75287105 CAGGGAAGGCGTCCTGATGATGG - Intronic
1085645280 11:78218599-78218621 CATGGCAGGACAGCTGCTGTGGG - Exonic
1087722650 11:101684119-101684141 CAAGGCAGCAGTGAGGCTGAGGG - Intronic
1088257405 11:107914224-107914246 CAGGGCAACAGTGCTGGAGAAGG + Intronic
1088658561 11:112025249-112025271 CGGGGCAGGAGTGTTCCAGAGGG - Exonic
1089559722 11:119337777-119337799 CTGGGCTGGAGTGCGGCTGCGGG + Intergenic
1202813080 11_KI270721v1_random:35613-35635 CAGGGCAGCTGTGCTCCAGAGGG - Intergenic
1091395741 12:153342-153364 CCAGCCAGGAGTGCTGCTGCGGG + Intronic
1091460997 12:643247-643269 CAGGACAGGAGGGTCGCTGAGGG - Intronic
1091589683 12:1835881-1835903 CAGGCCAGGAGTACTGAAGATGG - Exonic
1092201462 12:6586490-6586512 CAAGGCAGGAGAACTGCTTAAGG + Intronic
1092209648 12:6638023-6638045 CAGGGTAGCAGTGCTGAGGATGG + Intergenic
1092329598 12:7571528-7571550 CAGGGAAGGAGGGCTGGGGAAGG - Intergenic
1096080789 12:48830987-48831009 AAGGACAGGAGTGCTTCTCATGG + Intronic
1096889131 12:54748788-54748810 CTGGGCAAGAGTGATGGTGAGGG + Intergenic
1097287093 12:57886784-57886806 CAGGGGAGAAGTGTTACTGAGGG + Intergenic
1098304640 12:69090330-69090352 CAAGGCAGGAAGGCTGCTGAGGG - Intergenic
1098521637 12:71440155-71440177 CAGGTCTGGTGTGTTGCTGAGGG + Exonic
1099219454 12:79895726-79895748 CAGAGTAGCAGTGCTGGTGAAGG - Intronic
1100325475 12:93535903-93535925 CAGGGCAGGAGGCCAGCTAAAGG + Intergenic
1102037915 12:109782758-109782780 CAGGGCGAGAGTGATGCTGGTGG - Intergenic
1102061558 12:109935992-109936014 GAGGGCAGGAGTGAGGCTGGAGG + Intronic
1102156518 12:110734198-110734220 CAGAGCAGGACTGCTGCTGTGGG - Intronic
1103870106 12:124085299-124085321 CAGGGCAGGGCTGCCTCTGAAGG - Intronic
1104749672 12:131230243-131230265 CGGCTCAGGAGAGCTGCTGATGG - Intergenic
1104771389 12:131366820-131366842 CAGGGCAGGAGCCATGCTGCTGG + Intergenic
1104984111 12:132587066-132587088 GAGGGCAGCAGTGCGGCTGGAGG + Intergenic
1105293616 13:19070510-19070532 TTGGGCAGGAGCCCTGCTGAAGG + Intergenic
1106153470 13:27129489-27129511 CAGAGCAGGAGGACTGCTTAAGG + Intronic
1106274429 13:28190490-28190512 CAAGGCAGGAGGACTGCTTAAGG - Intronic
1106375105 13:29178561-29178583 CTGGGCTGAAGTGCTACTGAGGG - Intronic
1107826053 13:44330131-44330153 CAGGGCAAGCGTGCTGCTTGTGG - Intergenic
1107832207 13:44384545-44384567 CAGGGCAGGTGTGCAGGTGCAGG - Intronic
1108339671 13:49486086-49486108 CAAGGCAGGAGGGCTGCTTGAGG + Intronic
1108418882 13:50228617-50228639 TAGGGCAGTAGGGCTGCTGCAGG - Intronic
1108702470 13:52955523-52955545 GAGGTCAGGCGTGCTGCTGGGGG - Intergenic
1110464647 13:75787350-75787372 CAGCAGAGGAGTGCTGCTGCAGG - Intronic
1110796479 13:79644385-79644407 CAGGGTAGTAGTGAGGCTGAAGG - Intergenic
1111389581 13:87575333-87575355 CAAGGCATGATTGCTGCTTATGG - Intergenic
1111822819 13:93234117-93234139 CAGGGCCAGAGAGCTGCTAAGGG - Intronic
1111954760 13:94744085-94744107 CAGGGCAGCATTCCTTCTGAAGG - Intergenic
1112501742 13:99948219-99948241 GAAGGCAGGAGTGTGGCTGAGGG + Intergenic
1113093467 13:106638814-106638836 CAGTGCAGGAGAGGTGGTGACGG + Intergenic
1113587520 13:111475459-111475481 CAGGGGAGGGATGGTGCTGACGG + Intergenic
1113608177 13:111625024-111625046 CAGGGAAGGAGTGCTGTTTGCGG - Intronic
1113823541 13:113232430-113232452 CAGGGCAGGAGTGGTGCTGGTGG - Intronic
1114531883 14:23401617-23401639 CAGGGCAAGGGTGTGGCTGAGGG + Intronic
1114693714 14:24607831-24607853 CAGGGTAGGGCTGCAGCTGAGGG + Intronic
1116012438 14:39366943-39366965 CATGGCCGCTGTGCTGCTGAGGG + Intronic
1117686779 14:58261846-58261868 CAAGGCAGGAGGACTGCTTAAGG - Intronic
1118466666 14:66037519-66037541 CAGTGCGGCAGTGCTGCTGATGG + Intergenic
1119500133 14:75119081-75119103 CAAGGCAGGAGTACTGCTTGAGG + Intronic
1119677691 14:76568153-76568175 CAGGGCAGCATTCCTTCTGAAGG - Intergenic
1120984029 14:90317176-90317198 CAAGGCAAGAGGACTGCTGAAGG + Intronic
1121020885 14:90579342-90579364 CAAGGCAAGAGTGCTGAGGAAGG - Intronic
1121473311 14:94173810-94173832 CAGGGCTGGAGTTGTGCTGGGGG + Intronic
1121704604 14:95982152-95982174 CAGGGCAGCACTGCTGCTGATGG - Intergenic
1122402725 14:101476755-101476777 CTGGGCAGGGCTGCTGCAGATGG - Intergenic
1122792599 14:104190616-104190638 GAGGGCAAGGGGGCTGCTGAGGG + Intergenic
1122806020 14:104257573-104257595 CAGGACAGAGGTGCTGCAGAGGG + Intergenic
1202842888 14_GL000009v2_random:139555-139577 CAGGCCGGGCGTGCTGCTGGAGG - Intergenic
1202912285 14_GL000194v1_random:129803-129825 CAGGCCGGGCGTGCTGCTGGAGG - Intergenic
1124121335 15:26891797-26891819 CAGGGCCACAGTGCTGCTGCAGG + Intronic
1124208574 15:27743819-27743841 CGGGGCAGGGGTGCTGGTGAAGG - Intergenic
1124208694 15:27744432-27744454 CAGGCCAGCAGGGCTGGTGATGG + Intergenic
1124453800 15:29822337-29822359 GAGGCCACGGGTGCTGCTGACGG - Exonic
1125135950 15:36342811-36342833 CAAGGCAGGAGAGCTGCAAATGG + Intergenic
1126544115 15:49853746-49853768 CTGAGCAGGAGTGCTAATGAAGG - Intergenic
1127637892 15:60888823-60888845 CTGGGCAGGAGGCCTGCTGCTGG - Intronic
1127996006 15:64153450-64153472 CAGGTCAAGAGAGCTGGTGAGGG - Intronic
1128619104 15:69133761-69133783 CAGGGAAGGAGTGTGGCAGATGG + Intergenic
1129204173 15:74025576-74025598 CAGGTCAGGGGTGCTGCAGAAGG - Intronic
1129300283 15:74621439-74621461 GGTGGCAGGAGGGCTGCTGACGG + Intronic
1129443187 15:75597365-75597387 CAGGACACTAGTGCTGCTGGAGG + Intergenic
1129706390 15:77796932-77796954 CAAGGCAGGAGGACTGCTTAAGG - Intronic
1129916508 15:79278278-79278300 AAGGCCAGCAGTGCTGCTCATGG - Intergenic
1130351219 15:83093442-83093464 CAGCCCAGGAGTGAGGCTGAGGG - Intergenic
1130517141 15:84634074-84634096 CGGGGCCGGAGTCCTGGTGAGGG - Intergenic
1130528702 15:84728884-84728906 CAGGGCAGGAGGACTGCTTGAGG - Intergenic
1130648774 15:85750552-85750574 CAGGCCAGGATGGCTGCTGTGGG - Intergenic
1132314791 15:100881692-100881714 CAGTGCAGGAATGAGGCTGAGGG + Intronic
1132642177 16:982895-982917 GAGGGCAGGAGTGGAGATGACGG + Intronic
1132647438 16:1005469-1005491 CGGGGCAGGCGTGCTGGGGACGG + Intergenic
1132649519 16:1014220-1014242 CAGGGCAGGAGGGGGGCTGCAGG - Intergenic
1133261516 16:4553958-4553980 CACAGCAGGAGCCCTGCTGAGGG - Intergenic
1133364022 16:5196822-5196844 CAGGGCATGAGTGCCGCACAGGG + Intergenic
1134012997 16:10868959-10868981 GTGGGCAGGTGTGCTGCTGCTGG + Intergenic
1134098825 16:11437324-11437346 CAAGGCAGGAGGACTGCTGAAGG + Intronic
1134135039 16:11672189-11672211 CAGGGCAGGGGTACAGCTGTGGG + Intronic
1134242018 16:12513277-12513299 CAAGGCAGGAGGGCTGGGGAGGG - Intronic
1137446257 16:48534435-48534457 CTGGGGAGGGGTGCTGCGGATGG - Intergenic
1137798070 16:51238718-51238740 CAGGGCAGGGGTCCAGCTGGGGG - Intergenic
1138424889 16:56924796-56924818 AAGGGCAGGAGAGTTGCTGTGGG + Intergenic
1139636159 16:68259872-68259894 GATGGCAAGAATGCTGCTGATGG + Exonic
1139654756 16:68380597-68380619 AAGGGCAGAGGTGGTGCTGAGGG - Intronic
1141612866 16:85192971-85192993 TAGGGCAGGAGGGCTGTTGGAGG + Intergenic
1141624286 16:85253255-85253277 CAGGGCAGGACTGGGGCAGAGGG - Intergenic
1141641038 16:85341730-85341752 CAGGGCAGGAGGATTGCTTAGGG - Intergenic
1141693648 16:85610225-85610247 CAGGGCAGGTGTCCTGCTCTGGG + Intergenic
1141865839 16:86749228-86749250 AGGGGCAGGGGAGCTGCTGAGGG + Intergenic
1142256266 16:89015233-89015255 AAGGCCAGAGGTGCTGCTGAGGG + Intergenic
1142673003 17:1496040-1496062 CAGGTAAGCAGTGCTGGTGAGGG - Exonic
1143107252 17:4535961-4535983 TAGGGCAGGAGTGAGTCTGAGGG + Intronic
1143116041 17:4582374-4582396 CTGGGCAGGAGTGGAGCTAAAGG + Intergenic
1143144125 17:4762634-4762656 AAGAGCAGGAGTGCCGCTGTGGG - Intergenic
1145966881 17:28925472-28925494 AAGGGGAGTAGTGCTGGTGATGG + Intronic
1146293841 17:31632911-31632933 CAGGGTGTGAGAGCTGCTGAGGG - Intergenic
1146579734 17:34026243-34026265 CAGGGCAGGCATACTGCTGTTGG - Intronic
1146642967 17:34555173-34555195 CAGGGCAGGAGCCCAGCTAATGG - Intergenic
1147170552 17:38616440-38616462 CAGTGCAGGAGGGATGATGAAGG + Intergenic
1147344290 17:39778426-39778448 CAAGGCAGAAGTGTTGCTTAGGG - Intronic
1147718296 17:42522426-42522448 CAGGGCAGGGGGGCTGCACAAGG - Exonic
1147891470 17:43720566-43720588 CAGGCCAGGCGTGCTGCGGCAGG + Intergenic
1148113751 17:45162498-45162520 CAGGACATGAGTCCTGGTGAGGG + Exonic
1148475806 17:47927921-47927943 CAGAACAGGAGTGGGGCTGAGGG - Exonic
1148558949 17:48595073-48595095 CAGGGCAGGAGGCCAGGTGATGG - Intronic
1148897489 17:50847664-50847686 TATGGTAGGGGTGCTGCTGATGG + Intergenic
1149766882 17:59286467-59286489 CGAGGCAGGAGGGCTGCTTAAGG + Intergenic
1150712413 17:67543246-67543268 CAGGGCAGCTGCGGTGCTGATGG - Intronic
1151330621 17:73404876-73404898 CTGAGCAGCAGTGCTGCTGATGG + Intronic
1152309041 17:79537988-79538010 GGGGGCAGGGGTGCTGGTGAGGG + Intergenic
1152323982 17:79624921-79624943 CAGGGCAGGAGTCCTGCCCTTGG - Intergenic
1153117654 18:1679041-1679063 CAGGGCAGCATTCCTTCTGAGGG + Intergenic
1153586330 18:6624363-6624385 CAGGACAGAAGTGCTGAGGAAGG + Intergenic
1153662706 18:7339665-7339687 GAGAGCAGGATTACTGCTGATGG + Intergenic
1153744472 18:8162980-8163002 GAGGGCAGGTGTGTGGCTGACGG - Intronic
1153846422 18:9053533-9053555 TAGGGAATGGGTGCTGCTGATGG + Intergenic
1154338097 18:13481949-13481971 CAGGGCTGGAGTGGGGCTGGGGG + Intronic
1156378016 18:36532015-36532037 CAGGCCAGCAGTGAGGCTGAGGG - Intronic
1157816681 18:50734590-50734612 CAGGCCAGAGGTGCTGCGGAGGG - Intergenic
1158650055 18:59276156-59276178 GAGGGCAGGGGTGGTGGTGATGG + Intronic
1159206246 18:65256718-65256740 CAGGGCAGGAGAGTTGTTTAAGG - Intergenic
1159774415 18:72586199-72586221 CATGGCAGCAGTGCTCCAGATGG + Intronic
1160049132 18:75415354-75415376 CAGAGCAGGAGTGGGGCTGAAGG + Intronic
1160355697 18:78226619-78226641 CAGGGCTGGTGTGCAGGTGAAGG - Intergenic
1160554417 18:79716686-79716708 CAGGGCAGGCGGGCACCTGAGGG - Intronic
1160694964 19:479166-479188 CCGTGCAGAAGGGCTGCTGAGGG + Intergenic
1160701535 19:509850-509872 CAGGGCAAGGGTGGTGCTGGTGG + Intronic
1161060335 19:2211488-2211510 CAGGCCAGGGATGCTGCTCAGGG + Intronic
1161700333 19:5791012-5791034 CGGGGCAGGAGGGAAGCTGAAGG - Intronic
1161760483 19:6167573-6167595 GAGGAAAGGAGTTCTGCTGAAGG - Intronic
1161865010 19:6827127-6827149 CAGGGCAGGGGTGGTGAGGACGG + Intronic
1161978220 19:7617729-7617751 CTGGGCAGGAGTGCTGGAAATGG - Intronic
1162398882 19:10432720-10432742 AAGGCCTGGGGTGCTGCTGAGGG + Intronic
1162936856 19:13985804-13985826 CAGGGCAGGAGGGCTATTCAGGG + Intronic
1163348434 19:16759642-16759664 CAGGGCAGGAGGATTGCTGGAGG + Intronic
1163614462 19:18318452-18318474 CAGGGGAGGAGGGCTGCGGGCGG + Intronic
1164656089 19:29923054-29923076 GAGGGCTGGAGTGCTGCTGGAGG - Intergenic
1166944218 19:46387283-46387305 CTGGGCAGATGTGCTGGTGAAGG + Intronic
1166965309 19:46526295-46526317 CCGGGCAGGGGTGATGCTGGTGG + Intronic
1167121824 19:47521753-47521775 GAGGGCGGGGGTGCTCCTGATGG - Intronic
1167233204 19:48297969-48297991 CAGGGCAGGAGGGACGCAGAGGG - Intronic
1168723366 19:58567315-58567337 CTGGGCAGGGCTGCTGCTGTGGG + Intronic
925159761 2:1675900-1675922 CAGCGCAGGAGTGCTGGGGCTGG + Intronic
925288467 2:2730843-2730865 CAGGGCAGGAGTGTGCCTGGTGG - Intergenic
925556614 2:5137776-5137798 CAAGGCAGGAGGGCTGCTTGAGG + Intergenic
925597375 2:5569015-5569037 CAGAGCAGCACTGCAGCTGAGGG - Intergenic
926048764 2:9729789-9729811 CTGGCCAGGGGTGCTGCTGTGGG + Intergenic
926137674 2:10347897-10347919 GAGGGGAGGAGTGCTGTAGAAGG + Intronic
926195393 2:10760769-10760791 CAGGGCAGGGGTGCTTCAGATGG + Intronic
926392157 2:12404411-12404433 CAAGGCAGCAGGGCTGCTGTTGG + Intergenic
926634787 2:15167408-15167430 CAGGGCATGAATGATGATGAAGG - Intronic
926662205 2:15480106-15480128 CAAGGCAGGAGAGCTGCTTGAGG + Intronic
927713091 2:25337906-25337928 CAGGCCAGGTGGGCTTCTGACGG + Intronic
927962643 2:27250417-27250439 CCGGGCGGGAGGGCTGCTGGAGG + Intergenic
928327894 2:30334538-30334560 AATGCCAGTAGTGCTGCTGATGG + Intergenic
928603927 2:32926851-32926873 CAGGGGAGGAATGCTGATGGGGG - Intergenic
928775518 2:34757712-34757734 CAGCACAGAAGTGCTGCTCATGG + Intergenic
930152254 2:48070589-48070611 AAGGGCAGCAGTGCTGCTCTTGG + Intergenic
932205095 2:69873289-69873311 CAGGGCATGAGGGCTGTGGATGG + Intronic
933769270 2:85733024-85733046 TAGGCCAGGAGTGCTGGGGAAGG - Intergenic
934763293 2:96867911-96867933 CAGGCCAGCTGTCCTGCTGAGGG + Exonic
937010629 2:118559851-118559873 CAGGGCAGGAGTACTGCGGAAGG + Intergenic
937239561 2:120451423-120451445 CAGGGCAGGTGTGCTGCTGAGGG + Intergenic
937336159 2:121063587-121063609 CAGGGCAGCAGTGTGGCTGGGGG - Intergenic
938292717 2:130158719-130158741 CAGGGAAGTAGGGGTGCTGAGGG + Intronic
938324064 2:130385812-130385834 CAGGCCCGGGGTGCTGCTCATGG + Intergenic
938670229 2:133579526-133579548 CAGGGCAGGAGGCCAGTTGAGGG + Intergenic
938790327 2:134670460-134670482 CAGGGCAAGATTGCTGGAGAGGG - Intronic
939199649 2:139018213-139018235 CAGGGAAGGGGTGCTGGTGGGGG + Intergenic
939983725 2:148810872-148810894 CAGGGGAGGGGTGCTTCAGAAGG + Intergenic
945274923 2:207978547-207978569 CTGGCCTGGAGGGCTGCTGAAGG - Intronic
946044231 2:216807900-216807922 CAGGGCAGGGGTGGGGCTGCGGG - Intergenic
946084210 2:217154834-217154856 CTGGGCAGCAGTGCTGGTGGTGG - Intergenic
946669527 2:222087944-222087966 CAGGACAGAAATGCTGCTCAGGG + Intergenic
946828601 2:223704923-223704945 CAATGCAGGAGTCCTGCTGCTGG - Intergenic
948266161 2:236636520-236636542 CAGGGCAGCAGCAATGCTGATGG + Intergenic
948302084 2:236915033-236915055 CAGGGCAGGACTGCAGCCGAGGG + Intergenic
948544550 2:238717472-238717494 CAGGGCAGGTGGACTCCTGAAGG + Intergenic
948590690 2:239047747-239047769 CTGGGAAGGGGCGCTGCTGAGGG + Intergenic
948811525 2:240480857-240480879 CAGGCCTGGGGTGCTGGTGAGGG - Intronic
1169332422 20:4726743-4726765 CAGAACATGAGTGCTGATGAGGG + Exonic
1171026206 20:21632724-21632746 CAGGACATGAGGGCTCCTGAAGG - Intergenic
1171032718 20:21691692-21691714 TGGGGCAGGAGTGCAGCTGGTGG + Intergenic
1172008595 20:31833659-31833681 CAGGGCAGGGGGGCAGCTGCAGG - Intronic
1172703414 20:36865712-36865734 GTGGGCAGGAGTGCTGGAGAAGG + Intergenic
1172768111 20:37361763-37361785 CAGGGCAGGAGTGCTGCTGAGGG + Intronic
1173808714 20:45943071-45943093 CAGGACAGGAGAGCTGCTGAAGG - Intronic
1173961447 20:47075474-47075496 CATAGCAGGAGTGCTGGTTATGG - Intronic
1175413645 20:58787343-58787365 CAGGGGAGGAGGGCTGCTCAGGG + Intergenic
1175508588 20:59505453-59505475 CAGGGTTGGGGTGCTGCAGAAGG - Intergenic
1175909611 20:62398512-62398534 AAGGGCAGGTGTACTGCTGGGGG + Intronic
1176049207 20:63107769-63107791 CAGGGGAGCAGAGCTGCTGGTGG + Intergenic
1176169877 20:63691962-63691984 CAGGGCAGCTGTGATGCTGACGG + Intronic
1176221858 20:63973460-63973482 CAAGGCAGGAGTGTCGCTGAAGG - Intronic
1177944252 21:27447510-27447532 CAGGGAGGGAGTGATGGTGATGG - Intergenic
1178448447 21:32667614-32667636 CAGGGCTGGAGTGCTGTGGCAGG + Intronic
1178935707 21:36859824-36859846 CTGAGCAGCATTGCTGCTGAAGG - Intronic
1179574019 21:42295744-42295766 CAGGGCAGGACTGGAGCAGAGGG + Intronic
1180374961 22:12083134-12083156 CAGGCCAGGCATGCTGCTGGAGG + Intergenic
1180728323 22:17962440-17962462 CCGGGCAGGAGAGCTGGTGTGGG + Intronic
1182335066 22:29578540-29578562 CAGGCCAGAAGGGCTGCTGCTGG + Intronic
1182352716 22:29707764-29707786 CAGGGAAGGAGGCATGCTGAAGG + Intergenic
1183521510 22:38298488-38298510 CAGGGCATGGGTGGTGCTGGCGG - Intronic
1183664829 22:39241310-39241332 CAGGGCAGGCCTGCTGGTGGAGG - Intronic
1184021928 22:41826745-41826767 CAGGGCAGGGAAGCTGCAGAGGG + Intergenic
1184093831 22:42305912-42305934 GAGGGCAGGGGTGCTCCTGGGGG + Intronic
1184475796 22:44720628-44720650 CTGGCCAGGAATGCTGCCGAAGG - Intronic
1184903867 22:47465483-47465505 CAGGGGAGGTGGGGTGCTGAGGG - Intronic
1185049776 22:48547975-48547997 CAGGGCAGGACTGGGGCTGGAGG - Intronic
949864083 3:8532934-8532956 CAGGGAAGGATGGCTGCAGAGGG + Intronic
950841566 3:15973287-15973309 CAGGGTGAGAGAGCTGCTGATGG - Intergenic
951091085 3:18574583-18574605 CAGGACAGGAGCAGTGCTGAAGG + Intergenic
951319641 3:21228614-21228636 CGGGGCAGTAGATCTGCTGATGG + Intergenic
952872636 3:37914980-37915002 CAAGGCAGGAGGACTGCTGGAGG - Intronic
953079166 3:39599272-39599294 CGGGGCTGGAGTGCTTCTGTAGG + Intergenic
954004106 3:47578528-47578550 CAGGGCAGGGGTCCCGCTGGCGG - Intronic
954717143 3:52532602-52532624 CAGGGCAGGAGAGCTTCCGGAGG - Intronic
960784559 3:121357710-121357732 CTGGCCAAGACTGCTGCTGAAGG + Intronic
961635554 3:128330615-128330637 CAGGGCAGCAGTGTTCCTGTGGG + Intronic
962938727 3:140106152-140106174 CAGGGAAGGTATGCTGCTCAGGG - Intronic
963401677 3:144806497-144806519 CAGGGCAGTAGCTCTGCTAAGGG - Intergenic
964075250 3:152684812-152684834 GAGGCCAGGAGTGATGCTGAGGG - Intergenic
964805633 3:160606949-160606971 GAGGGCTGGAGTGCTTCTCAAGG + Intergenic
965153105 3:165008304-165008326 CAGGGCAGGAGTGGAGGGGAAGG - Intronic
968044058 3:195613659-195613681 CAGGGCAGGAGCGCTGATGAAGG - Intergenic
968059207 3:195714305-195714327 TAGGGCAGGAGTACTGGTCAGGG - Intergenic
968586261 4:1417629-1417651 CTGGGCAGGAGTGTTGGTCACGG - Intergenic
968697885 4:2041696-2041718 CAGGTCAGGAGCGATCCTGAGGG - Intronic
969407924 4:7007219-7007241 CAGGAGAGCAGTGCAGCTGAGGG + Intronic
969736049 4:8991393-8991415 CAGGGCAGGGGTTCTCCTTAGGG + Intergenic
972903782 4:43718970-43718992 GAGGGAAGGAGTGCTGGTCAGGG - Intergenic
973798453 4:54451830-54451852 CAGTGCTGGAGTTCTGCTAAGGG + Intergenic
974467293 4:62273500-62273522 GAGGGCAGAAGAGCTGCTGGTGG - Intergenic
975709942 4:77151014-77151036 CAGGGCTGCAGTCCTTCTGAAGG - Intergenic
978880210 4:113693189-113693211 CAGGCCAGGACTGCTGCTTGAGG - Intronic
979326912 4:119390981-119391003 CAAGGCAGGAGGACTGCTTAAGG - Intergenic
982120501 4:152138743-152138765 CAGAGCTGGAGGGCTGCTGGAGG - Intergenic
983175745 4:164586032-164586054 CAAGGCAGGAGTGAGGCTGGGGG + Intergenic
983244786 4:165275672-165275694 CAAGGCAGGAGGACTGCTTAAGG - Intronic
984193145 4:176628146-176628168 CAGGTCAGGAAGGCTGCAGAGGG + Intergenic
984896880 4:184548968-184548990 CAGGGAAGGAGGTCTGCTGAGGG - Intergenic
1202756548 4_GL000008v2_random:68583-68605 CAGGCCAGGCATGCTGCTGGAGG + Intergenic
985489825 5:172610-172632 CAGGGGAGGAGCCCTGCTCAGGG - Intronic
985529798 5:427177-427199 CAAGGCAGGAGTACCCCTGAAGG + Intronic
985856995 5:2436106-2436128 CAGGACAGGATTGCTGTTAAGGG - Intergenic
986497281 5:8356930-8356952 CAGGGCTGGAGTGGTGCCCAGGG + Intergenic
987784298 5:22479101-22479123 CAGGGCAGACCTGCTGCTGTAGG - Intronic
988093217 5:26569178-26569200 CAGGGAAGGAGTGAAGCTGGGGG - Intergenic
988850099 5:35172382-35172404 AAGGGAAGGAGTGAGGCTGAGGG + Intronic
990989177 5:61668671-61668693 TTGGCCAGGAGTGCTGGTGAAGG + Intronic
992406079 5:76459187-76459209 CAGCCCAGGACAGCTGCTGAGGG - Intronic
992850062 5:80797871-80797893 CAGCCCAGGACTGCTGCTTAGGG + Intronic
993351508 5:86855731-86855753 CAGGGCAGGCAGGCTGCAGATGG - Intergenic
995625898 5:114076259-114076281 AGGGGCAGGTGTGCTGCTGCTGG + Intergenic
997809472 5:136953551-136953573 CAGTGCTGGAGTTCTGCTCACGG - Intergenic
997926488 5:138035108-138035130 TAGGGTAGGAATGCTGCTGGAGG - Intronic
999178810 5:149654288-149654310 AGGGGCAGGAGTGCTGGTGCAGG + Intergenic
999182940 5:149682834-149682856 CAGAGCAGGAGGGAGGCTGAGGG + Intergenic
999477494 5:151914269-151914291 CATGTCAGGGGTGATGCTGACGG + Intronic
1000335285 5:160237548-160237570 CATGGCAGGGGTGCTGGTGGCGG - Intronic
1001329544 5:170752555-170752577 CAGGGCAGCACTGCTGCAGCGGG - Intergenic
1001389193 5:171365191-171365213 CAGGGCAGCACTGCGGCTAATGG + Intergenic
1002440527 5:179262188-179262210 CCGGGCAGGTGTGCTGGTGGGGG - Intronic
1002440537 5:179262214-179262236 CCGGGCAGGTGTGCTGGTGGGGG - Intronic
1004788841 6:19000490-19000512 CAGGGCAGGACTAGTGCTGGCGG - Intergenic
1007243834 6:40445770-40445792 CAGGCCAGGATTGAAGCTGAGGG - Intronic
1008536748 6:52512042-52512064 TGGGGCAGGAGAGCTGATGAAGG - Intronic
1010147808 6:72692382-72692404 CATGGAAGGAATGCTGCTGCAGG - Intronic
1010510083 6:76707738-76707760 CAGGGCCAGACTGCTTCTGAAGG + Intergenic
1012408909 6:98933449-98933471 GAAAGCAGGAGTGCTGCTGAGGG - Intronic
1012875755 6:104723821-104723843 CAAGGCAGGAGGATTGCTGAAGG - Intergenic
1014644448 6:123955858-123955880 CAAGGCAGGAGGACTGCTGGAGG - Intronic
1015604149 6:134938203-134938225 CAGGGCAGGAGTGCTGGGTGGGG - Intronic
1015618694 6:135106811-135106833 CGGGGCAGCAGTTCTGGTGAAGG + Intergenic
1016204788 6:141456810-141456832 CAAAGCATGAGTGCAGCTGAAGG - Intergenic
1016686641 6:146889608-146889630 CAGGGCAGGAGTCCTTGTGGAGG + Intergenic
1016829707 6:148421708-148421730 CAGGGCAAGAGTGCTGCTGGTGG - Intronic
1017356207 6:153512432-153512454 CAGGGCAGCAGTGCAGTTGGAGG - Intergenic
1018197275 6:161366326-161366348 CAGGACACCAGAGCTGCTGAGGG + Intronic
1018315636 6:162553935-162553957 CATGGCAGGAGGGCTGGGGAAGG + Intronic
1018838274 6:167501204-167501226 CAGGGCAGGAGGGCTGTGGCCGG - Intergenic
1018846384 6:167559782-167559804 CTTGGCAGGGGTGATGCTGAAGG + Intergenic
1018953093 6:168391655-168391677 CAGGACAGGTGTGCTGGGGATGG - Intergenic
1018953106 6:168391709-168391731 CAGGACAGGTGTGCTGGGGATGG - Intergenic
1018953119 6:168391763-168391785 CAGGACAGGTGTGCTGGGGATGG - Intergenic
1021150405 7:17144017-17144039 CAGGCCAGAAGTGTAGCTGATGG + Intergenic
1021417460 7:20404696-20404718 CAGTGCTGGGCTGCTGCTGAAGG - Exonic
1021440734 7:20671465-20671487 CAGGGGAGGAGGGCTGGAGAGGG - Intronic
1021994741 7:26168831-26168853 CAGGGGAGAAGTGTTCCTGAAGG + Intronic
1022265209 7:28746908-28746930 TAGGGCAGGAAGGCTGATGAAGG + Intronic
1022688006 7:32614619-32614641 CAAGGCAGGAGGGCTGCTTGAGG + Intergenic
1023555303 7:41416029-41416051 CTGGGCAGGAATTCTGATGAAGG + Intergenic
1023556628 7:41430140-41430162 AAGGGAAGGATTGCTGCTGCAGG - Intergenic
1023818138 7:43965768-43965790 CAGGGCAGGGGGGCTGCTCAGGG - Intergenic
1025294267 7:57763137-57763159 AAGTCCAGGAGTGCTGTTGATGG - Intergenic
1025928223 7:65975751-65975773 CAAGGCAGGAGGACTGCTGCAGG + Intronic
1026597927 7:71750120-71750142 CAAGGCAGGAGGACTGCTTAAGG - Intergenic
1026737684 7:72959566-72959588 CAAGGCAGGAGTATTGCTGGAGG - Exonic
1027106050 7:75405502-75405524 CAAGGCAGGAGTATTGCTGGAGG + Exonic
1027278103 7:76583246-76583268 AAGGGCAAGAGGGCTGCTGAGGG + Intergenic
1029566533 7:101342281-101342303 CAGGGCAGGAGGACTGCTTGAGG - Intergenic
1029742764 7:102500600-102500622 CAGGGCAGGGGGGCTGCTCAGGG - Intronic
1029760754 7:102599761-102599783 CAGGGCAGGGGGGCTGCTCAGGG - Intronic
1030266061 7:107623139-107623161 CAGGACAGGTGTGGTGCTTATGG - Exonic
1033400723 7:141021525-141021547 AAGGGCAGGAGTGGGGGTGAGGG - Intergenic
1033607963 7:142941318-142941340 AAAGGCTGGGGTGCTGCTGAGGG + Exonic
1033885742 7:145942909-145942931 CAAGGCAGTCCTGCTGCTGAGGG - Intergenic
1034707241 7:153156637-153156659 CAGAGCAGAAGGGCTGCTGGAGG + Intergenic
1038497595 8:28014824-28014846 CCGGGCAGGAGACCTGCAGAGGG + Intergenic
1039086794 8:33788208-33788230 CAAGGCAGGAGGACTGCTTAAGG - Intergenic
1042224554 8:66505288-66505310 CAGGGCAGGAGCTTTGCAGATGG - Intronic
1042954406 8:74233718-74233740 CATGGCAGGAGAGCTGCAAATGG + Intergenic
1046014065 8:108584856-108584878 CAGAGCAAAACTGCTGCTGAAGG + Intergenic
1047521617 8:125599399-125599421 CAGGGCAGGACAGATGCTGGTGG - Intergenic
1048257653 8:132917279-132917301 CAGGGCAGGTGTGCTGGGGTAGG + Intronic
1049181000 8:141222132-141222154 CAGGGCCTCAGGGCTGCTGAAGG + Intronic
1049196826 8:141320411-141320433 CAGGGCAGCAGAGCAGGTGAGGG + Intergenic
1049343485 8:142126359-142126381 CAGGGCAGGGGATCTCCTGAGGG + Intergenic
1049612655 8:143562630-143562652 CAGGGCAGGAGTGAGTCAGATGG - Intronic
1049818202 8:144618286-144618308 AAGGGCAGGGCTGGTGCTGAGGG + Intergenic
1054821949 9:69531539-69531561 CAAGGCTGGAGTGCTGGAGAGGG - Intronic
1054828027 9:69592361-69592383 CAAGGCAGGAGGCTTGCTGAAGG + Intronic
1055142538 9:72892248-72892270 GGGGCCTGGAGTGCTGCTGAGGG + Intergenic
1055633845 9:78254298-78254320 CAAGGCAGGAGTACTGCTTAAGG - Intronic
1056435145 9:86568704-86568726 CAAGACAGGGGTGCTGCTGTGGG + Intergenic
1056441600 9:86627484-86627506 GAAGGCTAGAGTGCTGCTGAGGG + Intergenic
1056554813 9:87679428-87679450 CAGGGCAGGAGTGGTGGGAAGGG + Intronic
1056811829 9:89771105-89771127 CAGGGCAGCAATACTGCTGTTGG + Intergenic
1057704762 9:97388728-97388750 CTGGTCAGCAGTGGTGCTGAGGG - Intergenic
1057800292 9:98186894-98186916 CAGGCCTGGAGTGCTGCTGTGGG - Intronic
1058377481 9:104339931-104339953 GAGGGGAGGAGTGCTTCTCATGG + Intergenic
1058812026 9:108649648-108649670 AAGGGCAGGGGTGATGCTGATGG - Intergenic
1059064299 9:111066420-111066442 CAGGGCAGGGGTGGTGGTGCAGG - Intergenic
1059155026 9:111982056-111982078 AAGGACAGGTGTGCTTCTGATGG + Intergenic
1059282803 9:113149280-113149302 CAGGGAAGGAGTGCCTCTGGTGG + Intergenic
1059403328 9:114084468-114084490 AAGGGCAGGAGTGCTTCTCCAGG - Intergenic
1059975740 9:119715041-119715063 CAGGGCAGGAGGACTGCTTGAGG + Intergenic
1060140910 9:121209178-121209200 TAGGGCAGGCCTCCTGCTGAAGG + Intronic
1203688156 Un_GL000214v1:15660-15682 CAGGCCAGGCGCGGTGCTGAAGG + Intergenic
1203537344 Un_KI270743v1:53440-53462 CAGGCCAGGCATGCTGCTGGAGG + Intergenic
1203648119 Un_KI270751v1:88393-88415 CAGGCCAGGCGCGGTGCTGAAGG - Intergenic
1186401540 X:9264886-9264908 CAGGGCAGGAGGACTGCTTGAGG + Intergenic
1186748709 X:12598552-12598574 CAGGGCACCAATGCTGCTGGTGG + Intronic
1187348229 X:18487529-18487551 CATGGCAGGAGGGCTGTTTAAGG - Intronic
1188744802 X:33829306-33829328 CAGAGCAGGTGTGCTGCTCTGGG + Intergenic
1189467458 X:41288175-41288197 CAAGGCAGGAGGACTGCTTAAGG + Intergenic
1190469485 X:50764087-50764109 CAGGTCAGCAGCGCTGTTGAGGG - Intronic
1190959701 X:55234323-55234345 CAGCGCTGGAGCTCTGCTGAGGG - Intronic
1192009317 X:67250831-67250853 CAGAGCTGGAGTTCTGCTAAGGG + Intergenic
1194178823 X:90688266-90688288 CAGACCATGAGAGCTGCTGAGGG - Intergenic
1196025564 X:111038086-111038108 CAGGGTAGGGGTGATTCTGAGGG + Intronic
1196124120 X:112081824-112081846 CACTGCCTGAGTGCTGCTGAGGG - Intronic
1198254580 X:134914358-134914380 AAGGGCAGGAGGGCTGGAGAGGG + Intronic
1199783652 X:151084693-151084715 CAGGGCAGCAGAGCAGCTCATGG + Intergenic
1200003323 X:153072834-153072856 CAGGGGAGGAGGGCGGCTGGGGG + Intronic
1200004400 X:153077175-153077197 CAGGGGAGGAGGGCGGCTGGGGG - Intergenic
1200525488 Y:4270436-4270458 CAGACCATGAGAGCTGCTGAGGG - Intergenic
1201243496 Y:11980832-11980854 CAGGGCAGGAGGACTGCTTGAGG - Intergenic
1201303255 Y:12528550-12528572 CAGGGCAGGAGGCCTGCATATGG + Intergenic
1201426010 Y:13851646-13851668 CATGGCAGCAGTGCGGCTGGGGG - Intergenic
1201690783 Y:16762470-16762492 CAAGGCAGCAGTGAGGCTGAGGG + Intergenic