ID: 1172770182

View in Genome Browser
Species Human (GRCh38)
Location 20:37377643-37377665
Sequence GGCCATGTGGACCCAGGTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 282
Summary {0: 1, 1: 0, 2: 5, 3: 24, 4: 252}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172770171_1172770182 28 Left 1172770171 20:37377592-37377614 CCGTGGGAGCATGGGACACACCA 0: 1
1: 0
2: 0
3: 20
4: 150
Right 1172770182 20:37377643-37377665 GGCCATGTGGACCCAGGTGATGG 0: 1
1: 0
2: 5
3: 24
4: 252
1172770178_1172770182 -10 Left 1172770178 20:37377630-37377652 CCACCAGCTGCAGGGCCATGTGG 0: 1
1: 0
2: 2
3: 36
4: 354
Right 1172770182 20:37377643-37377665 GGCCATGTGGACCCAGGTGATGG 0: 1
1: 0
2: 5
3: 24
4: 252
1172770175_1172770182 8 Left 1172770175 20:37377612-37377634 CCATGGGAGACGGCAGCACCACC 0: 1
1: 0
2: 1
3: 12
4: 183
Right 1172770182 20:37377643-37377665 GGCCATGTGGACCCAGGTGATGG 0: 1
1: 0
2: 5
3: 24
4: 252

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172770182 Original CRISPR GGCCATGTGGACCCAGGTGA TGG Intronic
900302709 1:1985993-1986015 GGCCATGTGGACACGGGTGGTGG + Intronic
900643133 1:3696782-3696804 AGCCATGTGGGGCCAGGGGAGGG + Intronic
900796442 1:4711438-4711460 GGCCCTGGGGTCCCAGGTGGAGG + Intronic
902396409 1:16134433-16134455 GCCCATGTGGAGCCAGGGTATGG + Intronic
902931617 1:19735433-19735455 GGCCATGAGGATCCAGGGGTGGG + Intronic
904459167 1:30665301-30665323 GGCCATGTGGAAGCGGGAGAGGG - Intergenic
905200751 1:36314935-36314957 ATCCATGTGGACCAAGCTGAGGG + Intronic
905894033 1:41533767-41533789 GGCCATCAGCACCCAGGTGGAGG - Intronic
906223811 1:44104497-44104519 GGCCATGCGCACCCAGGAGAAGG - Intergenic
909608836 1:77532389-77532411 GGCCAAATGGAACCAGGAGAGGG - Intronic
915601501 1:156925428-156925450 GGCAATGTGGAGACTGGTGATGG + Intronic
915619703 1:157073511-157073533 GGCCGTGTGCACCCAGGAGAAGG + Intergenic
916281982 1:163061757-163061779 GGCCTTGTTGACCCTGGTAAGGG - Intergenic
916437387 1:164789737-164789759 AGCCAGGTGGACCCACTTGAAGG + Intronic
918051654 1:180978465-180978487 CTCCAGGTGGACCCAGGCGAAGG + Intronic
918315918 1:183322638-183322660 GGCCATTGGGACCCAGGTAGTGG - Intronic
919145635 1:193630884-193630906 GGCCATGTGGATCCAATTAATGG - Intergenic
919808741 1:201396245-201396267 GGACATGTGTCCCCAGATGAAGG - Intronic
920648335 1:207819178-207819200 GGCAATGGGGACCCTGGTGACGG - Intergenic
922243665 1:223774161-223774183 GGCCAGGTGGACCCTGGAGTGGG - Intronic
923941219 1:238829574-238829596 GGCCATGTGCACCTAGGTGCTGG + Intergenic
924139525 1:241007808-241007830 GGTCCTGAGGGCCCAGGTGAGGG + Intronic
1064066671 10:12188050-12188072 GGTCATTTGGACCCAGGAGTTGG + Intronic
1067555116 10:47264145-47264167 GGTCATGTGGAAACAAGTGAAGG + Intergenic
1067966028 10:50913672-50913694 TGCAGTGTGGACCCGGGTGAAGG + Intergenic
1069941091 10:71955777-71955799 GGCTATGAAGACCCTGGTGAAGG + Intergenic
1070313217 10:75288601-75288623 GGCCAAGTGGGTCCAGGTGGTGG - Intergenic
1072614407 10:97039942-97039964 CGTCCTGTGGACCCACGTGAAGG + Intronic
1072783002 10:98262762-98262784 GGCACTGTGGGCCCAGGTCAAGG + Exonic
1073153033 10:101324614-101324636 TGCCATGTGGAAGCAGCTGATGG + Intergenic
1076408839 10:130231635-130231657 GTCCAAGTGGCCCCAGGTGCAGG - Intergenic
1076801084 10:132828915-132828937 AGCCGTGTAGACCCAGGGGATGG - Intronic
1076892834 10:133293159-133293181 CGCCATGCGCACCCTGGTGAAGG - Exonic
1077119289 11:899470-899492 GACCATGTGGGCCGAGGTGGCGG - Intronic
1077481535 11:2817072-2817094 GGGCATGTGGACTAGGGTGAGGG - Intronic
1077730432 11:4723896-4723918 GGCCATGCGCACCCAGGAGAAGG - Intronic
1078089841 11:8258243-8258265 GGCCCTCTGGACCCTGGAGATGG + Intronic
1078902914 11:15658287-15658309 GGGCATCTGGACCCTGGTCATGG - Intergenic
1079504326 11:21136340-21136362 GGCCATGTGGGCCATGGTAAGGG + Intronic
1080696289 11:34605772-34605794 GGCCATGTGGACCAAGGCAGTGG + Intergenic
1081595008 11:44453037-44453059 GGCCATAGGGACCCGGGTGTAGG - Intergenic
1082705624 11:56491200-56491222 GGGCATGTGGAGCCAGGCGTTGG + Exonic
1083764435 11:64835282-64835304 GGCAATGGGGAGCCAGTTGAGGG - Intronic
1083883282 11:65558597-65558619 GGCCAGACGGTCCCAGGTGAGGG - Intronic
1084698170 11:70768727-70768749 GGCCATGGGGAGCCTGGAGATGG + Intronic
1084956726 11:72695535-72695557 TGCCAGTGGGACCCAGGTGAAGG - Exonic
1084972139 11:72777772-72777794 GGACCTCTGGACCCAGGTAAGGG + Intronic
1086133435 11:83423288-83423310 AGCCAGGATGACCCAGGTGAAGG - Intergenic
1088620009 11:111672107-111672129 GGCCGTGTGTAACCAGGAGAAGG - Intronic
1089316231 11:117593148-117593170 GGACACGTGGGCCCAGGGGATGG - Intronic
1089701433 11:120246502-120246524 AGCCAGGTGGAGCCAGGTAAGGG + Exonic
1089748975 11:120636885-120636907 GGACATCAGGACCCAGGTGGAGG - Intronic
1089962735 11:122630136-122630158 ACCCATGTGGACCCAGGAGCAGG + Intergenic
1091018827 11:132080314-132080336 GGCCATGTGGGCACAGCTGGTGG - Intronic
1091992103 12:4963858-4963880 GGCCATGTGGTCCGAGGTGGGGG + Intergenic
1096627537 12:52904705-52904727 GGCCGTGCGCACCCAGGAGAAGG - Exonic
1098264606 12:68705888-68705910 AGCTGTGTGCACCCAGGTGAAGG + Intronic
1098290348 12:68951937-68951959 GGCCATGGGAAACCATGTGAGGG + Intronic
1100347168 12:93743456-93743478 GGGCCTGTGGTCCCAGGTGCTGG - Intronic
1102059786 12:109923687-109923709 GGCCTTCTGGAACCAGGAGAGGG - Intronic
1103004247 12:117408746-117408768 GGACAGCTGGGCCCAGGTGACGG - Intronic
1103714332 12:122935230-122935252 GACCCTGTGGGCCCAGGAGAGGG + Intronic
1103928269 12:124435638-124435660 GGGCACGTGGGGCCAGGTGAGGG - Intronic
1104666219 12:130649370-130649392 GGCCATGAGGCCCCAGGGGTTGG - Intronic
1104792942 12:131495017-131495039 GGCAACGTGGACACAGGTGATGG + Intergenic
1107307624 13:39038842-39038864 GGCAGTTTGGACCCAGGTGCAGG - Intronic
1108357001 13:49637045-49637067 GCCCATGTTGACCCAGGTGCTGG - Intergenic
1108548276 13:51518363-51518385 GGCCACGTGGACACAGGAGCCGG - Intergenic
1112431917 13:99357792-99357814 GGATATGAAGACCCAGGTGATGG - Intronic
1113453282 13:110428477-110428499 GGCAAGGTGGGCCCAGGGGAAGG + Exonic
1114619785 14:24088445-24088467 GGCAAAGTGGGCCCAGCTGAGGG + Intronic
1115951521 14:38727295-38727317 GGCCACGTGCACCCAGGAGAAGG + Intergenic
1116826361 14:49677073-49677095 AGCCATGTGGACCTAGTGGAGGG + Intronic
1121791898 14:96705044-96705066 GGGCATGTGGAGGCAGGGGAAGG - Intergenic
1122117214 14:99533799-99533821 GGGCAGGTGGACACAGGTTATGG + Intronic
1122559857 14:102605144-102605166 TTCCATGTGGCCCCAGGTGTTGG + Intronic
1122815104 14:104308290-104308312 GGGCATGAGGACCCAGTTGAGGG - Intergenic
1122900521 14:104780468-104780490 GGCCAGCTGGACGCAGGGGATGG + Intronic
1125757320 15:42072386-42072408 TGCCCTCTGGCCCCAGGTGATGG - Exonic
1126677148 15:51170248-51170270 CAGGATGTGGACCCAGGTGAAGG - Intergenic
1127726877 15:61758979-61759001 GGCAATGAGGACCCAAGAGATGG + Intergenic
1128314863 15:66654039-66654061 GGGCGGGTTGACCCAGGTGAAGG - Intronic
1128360283 15:66957024-66957046 GGCCTTATGGAACTAGGTGATGG - Intergenic
1128768680 15:70266270-70266292 GGCCAAGGGGCACCAGGTGAAGG + Intergenic
1128869723 15:71144878-71144900 GTCCATGTGGACCAAAGTGTAGG + Intronic
1128997662 15:72308649-72308671 GGCAATGAGGATCCAGGGGAGGG + Intronic
1129394322 15:75235888-75235910 GGAGATGAGGACCCAGGAGATGG - Intergenic
1129598032 15:76980175-76980197 GGCCATGCACACCCAGGAGAAGG - Intergenic
1130159910 15:81388394-81388416 GGCCATCTAGACCCAGGTCACGG - Intergenic
1130410023 15:83639545-83639567 GGCCAAGTGCACGCTGGTGAAGG + Intergenic
1131068324 15:89448380-89448402 GGGCATGAGGACCCAGGATAGGG - Intergenic
1131087055 15:89585711-89585733 GCTGATGTGGACCCTGGTGAAGG + Exonic
1132591843 16:729507-729529 GGCCAGCTGGACCCACATGAGGG + Exonic
1132625845 16:891120-891142 GGCCACGTGGACACAGGGGAAGG + Intronic
1133256298 16:4518467-4518489 GGCCCTGCGGCCCCCGGTGAGGG - Intronic
1134671178 16:16056267-16056289 GGGCGTGCAGACCCAGGTGAAGG - Exonic
1137537130 16:49335977-49335999 AGCCACGTGGGACCAGGTGAGGG - Intergenic
1139582946 16:67883997-67884019 GCCCATGTGGTCCCGAGTGATGG - Exonic
1141076380 16:81009474-81009496 GGCCTTGTAGACCATGGTGAAGG + Intronic
1141530116 16:84640528-84640550 GGCCATGGGAACCCAAGCGAAGG - Intergenic
1142007219 16:87695215-87695237 GCTCATGTGGCACCAGGTGAGGG - Intronic
1143703063 17:8675808-8675830 GGCAAAGGGGAGCCAGGTGAAGG - Intergenic
1144812863 17:18011907-18011929 GATCATGTGAACCCAGGTGGTGG - Intronic
1144826666 17:18109085-18109107 GGCCATGAGGCCCTAAGTGAGGG + Intronic
1145398636 17:22514485-22514507 GGCCCTGGTGCCCCAGGTGAGGG - Intergenic
1145978612 17:28998408-28998430 GGCCCTGGGGACCCAGGGGTAGG + Intronic
1146462165 17:33054951-33054973 GGCCATGTGGCCAATGGTGATGG - Intronic
1147350177 17:39836120-39836142 GGCCGTGTGCACTCAGGAGAAGG - Intronic
1151207614 17:72519453-72519475 GGCCCTGTGATCCCAGGTGGAGG - Intergenic
1151786850 17:76279286-76279308 GGACAGGTGGACACAGGTGAAGG + Intronic
1152388450 17:79989097-79989119 GGCCATGTGGAGCCCTGAGAAGG - Intronic
1152577391 17:81148941-81148963 GGCGAGGTGTCCCCAGGTGAGGG + Intronic
1152745385 17:82036407-82036429 GGACATGCTGACCAAGGTGATGG - Exonic
1153522016 18:5962466-5962488 GGCCACGTGGTTCCAGGTGTGGG + Intronic
1153966847 18:10190142-10190164 GGCCAGGTGGACACTGGGGACGG + Intergenic
1158868952 18:61665698-61665720 AGCCATGTGGAACTTGGTGATGG - Intergenic
1159102007 18:63968360-63968382 GGCCATGTGGACGCTGTTGGTGG - Intronic
1160191918 18:76721871-76721893 GGCCTTGTGGTTCCAGGTGGAGG - Intergenic
1160451855 18:78971789-78971811 GGCCATGTGGAACCCTGTGATGG - Intergenic
1160478019 18:79210346-79210368 GGCCATGTGGACCCACGCCTGGG + Intronic
1160538764 18:79609404-79609426 GGCCATGTGGGCCCAGCTTTGGG + Intergenic
1160957497 19:1700228-1700250 CCCCATGGGGACCCAGGTGTCGG + Intergenic
1161080640 19:2308303-2308325 GGCCACGTGGGCGCAGGTGCGGG + Intronic
1161667759 19:5587343-5587365 GGCCACGTGGTGCCAGGTGGCGG - Exonic
1161851176 19:6738930-6738952 GGCCATCTGGGCCCTGGAGAAGG - Intronic
1162481323 19:10928578-10928600 GCCCAGGTGGCCTCAGGTGAGGG - Exonic
1163128855 19:15259445-15259467 GGCCATGAGCACCCAGGGAATGG - Intronic
1163636320 19:18438604-18438626 GGACATGGGGAGCCAGGGGATGG - Intergenic
1163759700 19:19129352-19129374 GGTCATGTGGGCCATGGTGAGGG + Intronic
1165226331 19:34357756-34357778 GGAGATGTGGGCCTAGGTGAGGG + Intergenic
1165608260 19:37126031-37126053 GGAAATGTGGACCCAGATGTTGG + Intronic
1166385132 19:42376462-42376484 GGCCCTGGGGACCCATGGGAGGG + Exonic
1167348347 19:48960809-48960831 GGCCCTGTGCACCAAGGTGCCGG + Exonic
1167606802 19:50485595-50485617 GGCCATGGAGACAGAGGTGACGG - Exonic
1168661894 19:58173818-58173840 GGACATGGGGACCCTGGTGGAGG - Intergenic
925279036 2:2670020-2670042 GGGGATGTGGTCCCAGGTCAGGG - Intergenic
925279051 2:2670056-2670078 GGGGATGTGGTCCCAGGTCAGGG - Intergenic
925279066 2:2670092-2670114 GGGGATGTGGTCCCAGGTCAGGG - Intergenic
925279093 2:2670164-2670186 GGGGATGTGGTCCCAGGTCAGGG - Intergenic
925417415 2:3680330-3680352 GGTGATGTGGACCCAGGTCTGGG + Intronic
925989128 2:9239648-9239670 GGCCATTTGGACCCATCTAAGGG + Intronic
927851893 2:26504614-26504636 GACCTTGTGCCCCCAGGTGAAGG + Intronic
927851954 2:26504865-26504887 GTCCAGGTGGAGCCAGGTGTAGG + Intronic
929084989 2:38159294-38159316 GGTTATGTGGACACAGATGATGG + Intergenic
931514321 2:63035747-63035769 GGCCAATTGTACCCTGGTGAAGG - Intronic
932039346 2:68282504-68282526 TGCCATGTCAACCGAGGTGATGG + Intergenic
933957868 2:87386282-87386304 AGCCACGTGGACACAGCTGAAGG + Intergenic
934897606 2:98132337-98132359 GGCCATGGGGCCCCAGCTGGAGG + Intronic
936463015 2:112725530-112725552 GGACATCTGGGCCCAGGAGAAGG + Exonic
937232217 2:120404839-120404861 GGCCATGTGGACACTGGACAGGG - Intergenic
937908340 2:127063545-127063567 GGCCATGGGGACCCCTCTGAGGG - Intronic
937912139 2:127080943-127080965 GCCCCTGTGGACCCGGGTGCCGG - Intronic
938590231 2:132728809-132728831 TGCCACCGGGACCCAGGTGAGGG - Exonic
944763545 2:202841494-202841516 GGCCGTGTGCACCCAGGAGAAGG - Intronic
946484110 2:220084599-220084621 GGCCCTGGGGTCCCAGGGGAGGG - Intergenic
946662635 2:222018034-222018056 TGCTATGGGGACCTAGGTGAAGG + Intergenic
947854694 2:233315137-233315159 GGGCCTGTGGGCCCAGATGATGG + Intronic
948206613 2:236166042-236166064 GGCCAAGTGGAAACGGGTGAAGG - Exonic
1169737070 20:8848703-8848725 GGCCATGAGGGCCCAAGGGATGG + Intronic
1170666558 20:18391760-18391782 GGCCATGAGGACACTGGTCAAGG + Intronic
1170794364 20:19533515-19533537 ACCTATGTGGAGCCAGGTGAAGG + Intronic
1171455826 20:25271643-25271665 GGCCATGTGGACCAAGAAGCCGG - Intronic
1171796206 20:29568230-29568252 TGCCATGTGGATGCAGGTGGAGG - Intergenic
1171852030 20:30315937-30315959 TGCCATGTGGATGCAGGTGGAGG + Intergenic
1172770182 20:37377643-37377665 GGCCATGTGGACCCAGGTGATGG + Intronic
1173202809 20:40966593-40966615 GGCCTTGTGGCCACAGATGAGGG - Intergenic
1173316670 20:41950884-41950906 GGCCTTGTGGACCACTGTGAAGG + Intergenic
1174322187 20:49750668-49750690 GGCCATCTTGACCCAGGAGTGGG - Intergenic
1174449103 20:50608999-50609021 GGACCTGTGGTCCCAGGTCAGGG - Intronic
1175246445 20:57585053-57585075 GACCATGGGGACCCTGGTCAGGG + Intergenic
1175408295 20:58749523-58749545 GGCCATCTGGAGCAAGGCGAAGG + Intergenic
1175985350 20:62761671-62761693 GGCCATGTCGACCCAGGACCCGG + Exonic
1176059246 20:63165110-63165132 GGCCGATTGGACCCAGGTGGCGG - Intergenic
1179280818 21:39932432-39932454 GCCCATGTGGAGACAGGTGCAGG + Intergenic
1179540211 21:42078982-42079004 GGCCATTAGGACACAGGTGCTGG + Intronic
1179644425 21:42766930-42766952 GGACAAGTGAACCCAGCTGAAGG + Intronic
1179888781 21:44325649-44325671 GGGCATGGGGCCCGAGGTGATGG + Intronic
1180246665 21:46553034-46553056 GGCCAGGTGGTCCCAGGTAGGGG + Intronic
1183937355 22:41270820-41270842 GGCCCTGTGGACCCACGTGCAGG - Intronic
1184383662 22:44162003-44162025 GGCCATGTCCACCCAGGGGCGGG - Intronic
1184455236 22:44606471-44606493 GGCTGTGTGGACCCCGGTGCTGG - Intergenic
1184499186 22:44861663-44861685 GGCCATGTGGACCAACGTGAGGG - Intronic
1184842252 22:47058863-47058885 GGCCCGCTGGACCCAGGTGAAGG + Intronic
1184946264 22:47806327-47806349 GGGCAGGAGGACCCAGGGGAAGG - Intergenic
949354830 3:3169216-3169238 GGCCATGTTTAACCAGGTAAAGG - Intronic
950416786 3:12873392-12873414 AGCCATGTGGCCCCAAGTGCAGG + Intergenic
950486067 3:13274587-13274609 GGACATGTGGTCGCAGGGGAGGG - Intergenic
952881167 3:37987093-37987115 GTCAATATTGACCCAGGTGAAGG - Intergenic
954131404 3:48562961-48562983 GGCCATGTGGGAGCAGCTGAGGG + Exonic
954708466 3:52493556-52493578 GGGGAGGTGGACCCAGGTGGTGG + Intergenic
957966080 3:87323522-87323544 GGCCATGTGCACCCAGGAGAAGG + Intergenic
961333518 3:126156689-126156711 GGCCATGTGACCACAGGTCACGG + Intronic
962378852 3:134880615-134880637 GGCCTTGTGGCCTCTGGTGATGG - Intronic
962712911 3:138102641-138102663 GGCCATGTGCACCCAGGAGAAGG - Intronic
962796504 3:138854024-138854046 GGCTATGTGAATTCAGGTGAAGG - Intergenic
963907199 3:150782549-150782571 GGCCATGGGAACCCAGGGAAGGG + Intergenic
964880999 3:161422813-161422835 GGTGATTTGGACCAAGGTGATGG - Intergenic
965605667 3:170495695-170495717 GGCCATGCACACCCAGGAGAAGG + Intronic
967219654 3:187237779-187237801 GGCCATTTGGAACCAGGAGGAGG - Intronic
967887190 3:194341344-194341366 GCCCAAGTGGTCCCGGGTGACGG + Exonic
968486996 4:867618-867640 TGCCATGGGGACCCTGGTGCTGG - Intronic
969488443 4:7485456-7485478 GGCCCTGGGGCTCCAGGTGAGGG - Intronic
969488492 4:7485658-7485680 GGCCGTGTGGACCCAGCAGAGGG + Intronic
969850565 4:9953385-9953407 GGCCAGGTGGGCCCAGATGTGGG + Intronic
969871326 4:10106918-10106940 TGCCATCTCGACCCAGCTGATGG - Intronic
971792731 4:31189337-31189359 TGACATTTGAACCCAGGTGAAGG - Intergenic
977577911 4:98694279-98694301 CGCCATCTGCATCCAGGTGAAGG + Intergenic
983682576 4:170370878-170370900 GGCCCTGTGGACCAAGGGCAAGG + Intergenic
985077107 4:186226722-186226744 GGCCATGTGGACCCAGATGCTGG - Intronic
987400482 5:17470485-17470507 GGCCCTGGTGAGCCAGGTGATGG + Intergenic
990572113 5:57089523-57089545 GCCTATGAGGAACCAGGTGAGGG - Intergenic
990818027 5:59807316-59807338 GGCCATGAGCTCCCAGGTCACGG - Intronic
992548284 5:77836886-77836908 GGTCATGTAGACCATGGTGAGGG - Intronic
992782863 5:80143744-80143766 GGCCATCTTGACCCAGAAGATGG + Exonic
994320903 5:98393250-98393272 GGCCGTGCGCACCCAGGAGAAGG - Intergenic
996433016 5:123402067-123402089 GGCTGTGTGCACCCAGGAGAAGG - Intronic
997815611 5:137014416-137014438 GGCCATGTGGTCCCAAGTAGGGG + Intronic
998049771 5:139022713-139022735 TGCCATGTGGCCCCAGGCCATGG + Intronic
998370449 5:141657396-141657418 GGCCATGTGGGCCATGGTAAGGG + Intronic
998403939 5:141863153-141863175 AGCCATCTGGACCGAGGTGTGGG - Intronic
998994366 5:147854441-147854463 GGCCATTTGGGGCCAGATGAAGG - Intergenic
1002427047 5:179182623-179182645 TGACATGTGGACCCTGCTGAGGG + Intronic
1003399288 6:5778718-5778740 GGCCATGTGGCCCCAACTGTTGG + Intergenic
1005315345 6:24598287-24598309 GGCCATGTGCACCCAGGAGAAGG + Intronic
1005412342 6:25563471-25563493 GGACTTGTTTACCCAGGTGATGG + Intronic
1007965475 6:46000435-46000457 GTTCATCTGAACCCAGGTGATGG + Intronic
1012958963 6:105602063-105602085 GGGCATGTGGACCCCAGAGAGGG - Intergenic
1013009959 6:106110920-106110942 GGCCATGTGGCCCTATGTGATGG + Intergenic
1014125995 6:117777583-117777605 CGCCATGGGTACCCAGGGGAAGG - Intergenic
1014609231 6:123520725-123520747 GGCTATGTAGCCCCAGGAGAAGG - Intronic
1016065715 6:139681080-139681102 GGCCATGTGGAGGGAGGTGGAGG - Intergenic
1016841040 6:148525803-148525825 GGCCATGTGGGGCCAGGTACTGG - Intronic
1017023130 6:150157688-150157710 GGGGAAGTGGACACAGGTGAAGG + Intronic
1017822175 6:158057359-158057381 GGCCCTGCCGACCCAGGTAAGGG - Intronic
1023289557 7:38655459-38655481 GGCCATGCGCACCCAGGAGAAGG + Intergenic
1027352678 7:77327726-77327748 GGCCAAGTGAAACCAGGGGAGGG - Intronic
1031013274 7:116546296-116546318 GGCCATGTGGACGCGAGAGATGG + Intronic
1032459002 7:132095513-132095535 GGCCATGAGGATCCTGGGGAAGG + Intergenic
1034391986 7:150794099-150794121 GGGCATGTGGACTCACGGGAAGG - Intronic
1034541567 7:151761833-151761855 GGCCATGAGGACAAAGGTCAAGG - Intronic
1034696560 7:153059225-153059247 GTCCATGGTGACCCAGGAGAGGG + Intergenic
1035058962 7:156055205-156055227 GGCCATGTTGACACAGGTGGGGG - Intergenic
1035133886 7:156681221-156681243 GGCCATGGGCACCCAGCAGATGG + Exonic
1035368416 7:158363109-158363131 GGCCATCTGGCCCCAGGGAAAGG - Intronic
1036472206 8:9062118-9062140 GGCCATGTTGTAGCAGGTGAGGG + Intronic
1036651295 8:10645839-10645861 TGCCATGTGGAGCCTGGTGCAGG - Intronic
1037630258 8:20649385-20649407 GGCCACCTGCACCCAAGTGAGGG - Intergenic
1038659598 8:29485952-29485974 GGAAATGAGTACCCAGGTGATGG + Intergenic
1041671297 8:60494093-60494115 GGCTATGAAGACCCCGGTGAAGG + Intergenic
1041781041 8:61578474-61578496 GGCTGTGTGCACCCAGGAGAAGG + Intronic
1042837747 8:73093049-73093071 GGCCATGAGGACCCTGTGGATGG - Exonic
1044420490 8:91990396-91990418 GGTGATGTGGACACAGGAGATGG + Intronic
1045105903 8:98892421-98892443 GGCCTTGAGGACCCAGCTAATGG - Intronic
1047337298 8:123949001-123949023 AGCCATGTGGACACAGAGGAGGG + Intronic
1047833181 8:128658303-128658325 GTCCAGCTGGGCCCAGGTGAAGG - Intergenic
1048304678 8:133275601-133275623 GGTGATATGGAGCCAGGTGATGG - Intronic
1048596353 8:135870878-135870900 GGCCATGTTGACCCTCTTGAAGG - Intergenic
1049220206 8:141425568-141425590 GGCCCTGGGGACCCAGGTCTGGG + Intronic
1053789813 9:41679193-41679215 TGCCATGTGGATGCAGGTGGAGG + Intergenic
1054155327 9:61635563-61635585 TGCCATGTGGATGCAGGTGGAGG - Intergenic
1054178153 9:61890883-61890905 TGCCATGTGGATGCAGGTGGAGG + Intergenic
1054659376 9:67689941-67689963 TGCCATGTGGATGCAGGTGGAGG - Intergenic
1055025042 9:71710812-71710834 GGCCATGTGACTCCAGGGGATGG - Intronic
1056756245 9:89383683-89383705 GGACATGTGGAGCTAGGTGGGGG + Intronic
1057792273 9:98132178-98132200 GGCCTTGTGGGACCAGGTGAGGG - Exonic
1057943538 9:99305414-99305436 GGCCGTGTGTACCCAGGAGAAGG + Intergenic
1058561975 9:106239963-106239985 GGCCCTGGGGAACGAGGTGAGGG + Intergenic
1059347681 9:113641060-113641082 ATCCATGTGGACCCAGGCCAGGG - Intergenic
1059410244 9:114127239-114127261 GGCTATGGGAACCCAGCTGAGGG - Intergenic
1060482699 9:124026514-124026536 GGGCATGTGGAGCAAGGTGTGGG + Intronic
1061390403 9:130314608-130314630 GGCAAAGTGGACCCCGGGGAGGG - Intronic
1061815569 9:133192528-133192550 GACCATGATGACCCAGGTGTTGG + Intergenic
1061832569 9:133304876-133304898 GGCCAGGTGGACTCAGGGCATGG + Intergenic
1185469539 X:374180-374202 GGCCTCGGGGACCCAGGCGAAGG + Intronic
1188005714 X:25014470-25014492 GGCCCTGTGGCCCCAAGTGCAGG + Intronic
1190732449 X:53234614-53234636 GGCCATGTGGAGCAAACTGAGGG + Exonic
1191844233 X:65534550-65534572 GGCCGAGTGGGACCAGGTGACGG - Exonic
1195587867 X:106586390-106586412 GGCCAAGTGTACACAGGAGAAGG + Intergenic
1197240017 X:124114015-124114037 CACCCTGTGGACCCAGGTGCTGG - Intronic
1199927155 X:152479831-152479853 GGCCGTGCGCACCCAGGAGAAGG + Intergenic
1200022854 X:153226384-153226406 GGCGATGTGGTCAGAGGTGAAGG + Intergenic
1202625302 Y:56851042-56851064 TGCCCTGAGCACCCAGGTGATGG + Intergenic