ID: 1172771671

View in Genome Browser
Species Human (GRCh38)
Location 20:37385832-37385854
Sequence CCCCGGGGACGGACGCGGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 98}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172771663_1172771671 -7 Left 1172771663 20:37385816-37385838 CCAGCACTGCCCAAAGCCCCGGG 0: 1
1: 0
2: 3
3: 28
4: 290
Right 1172771671 20:37385832-37385854 CCCCGGGGACGGACGCGGACAGG 0: 1
1: 0
2: 1
3: 9
4: 98
1172771659_1172771671 13 Left 1172771659 20:37385796-37385818 CCAAACAGATAAGCCAGCACCCA 0: 1
1: 0
2: 0
3: 17
4: 160
Right 1172771671 20:37385832-37385854 CCCCGGGGACGGACGCGGACAGG 0: 1
1: 0
2: 1
3: 9
4: 98
1172771661_1172771671 -6 Left 1172771661 20:37385815-37385837 CCCAGCACTGCCCAAAGCCCCGG 0: 1
1: 0
2: 4
3: 26
4: 453
Right 1172771671 20:37385832-37385854 CCCCGGGGACGGACGCGGACAGG 0: 1
1: 0
2: 1
3: 9
4: 98
1172771660_1172771671 0 Left 1172771660 20:37385809-37385831 CCAGCACCCAGCACTGCCCAAAG 0: 1
1: 5
2: 5
3: 38
4: 413
Right 1172771671 20:37385832-37385854 CCCCGGGGACGGACGCGGACAGG 0: 1
1: 0
2: 1
3: 9
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172771671 Original CRISPR CCCCGGGGACGGACGCGGAC AGG Intronic
904690789 1:32292090-32292112 CCCCTGGGTCGGACGCTGAGCGG + Exonic
906720121 1:47997834-47997856 GCTCGGCGGCGGACGCGGACTGG + Intergenic
907521019 1:55023483-55023505 CCCCGGTGCCGGTCACGGACTGG + Intergenic
913222027 1:116667556-116667578 CCCCGGGGAGGGAGGCGGGGAGG - Intronic
915485432 1:156216837-156216859 CCCCGGGAGCGGAGGCGGGCCGG - Intronic
916773414 1:167936062-167936084 GCCGGGGGCCGGAGGCGGACCGG - Intronic
919958103 1:202438927-202438949 CCCCGAAGACGGCCGTGGACTGG + Intronic
922753751 1:228082900-228082922 GGCCGGGGGCGGACGCAGACGGG + Intronic
923463796 1:234231150-234231172 TTCCGGGGACGGACGGGGAAGGG + Intronic
1064231005 10:13529115-13529137 CCCCGGGGATGGCGGCGGCCGGG - Intergenic
1070914526 10:80144468-80144490 CCCTGGGGACGGAAGCGGGACGG + Intronic
1072591582 10:96832610-96832632 CCCCGGGGAGGCGCGCGGAGGGG - Intronic
1077011536 11:381296-381318 CCCCGGGGCCGGGGGCGGAGAGG - Intronic
1077011551 11:381328-381350 CCCCGGGGCCGGGGGCGGAGAGG - Intronic
1077011580 11:381392-381414 CCCCGGGGCCGGGGGCGGAGAGG - Intronic
1077011609 11:381456-381478 CCCCGGGGCCGGGGGCGGAGAGG - Intronic
1077011638 11:381520-381542 CCCCGGGGCCGGGGGCGGAGAGG - Intronic
1077011667 11:381584-381606 CCCCGGGGCCGGGGGCGGAGAGG - Intronic
1080654946 11:34251481-34251503 CCCAGGGGAAGGAGGAGGACAGG - Intronic
1081488045 11:43547085-43547107 CCCCGGGGGCGGACACGTGCTGG + Intergenic
1085784866 11:79440260-79440282 CCCCGGAGCCCGCCGCGGACTGG - Intronic
1089671860 11:120062316-120062338 CCCCGGGGGCGGAGGCAGAGGGG + Intergenic
1096622733 12:52874487-52874509 CCCCGGGGGAGGACGCGAAGGGG - Intergenic
1122379033 14:101288354-101288376 CCCCTGGGAAGGGCGCTGACTGG + Intergenic
1131144368 15:90001745-90001767 CCCTGGGGACGGCCGCGCGCAGG + Intronic
1132044023 15:98548870-98548892 GCCAGGGGACGGGCGCGGAGGGG - Intergenic
1132807800 16:1783085-1783107 CCCCGGGAAGGGACGCGGCGGGG - Intronic
1136242168 16:28951244-28951266 CCCCGGGGCCGGTCGCGTCCCGG + Exonic
1136913337 16:34161301-34161323 CCCCCGGGCCGGACAGGGACAGG + Intergenic
1141132149 16:81444387-81444409 CCCCCGGGCCGGACTCGGACGGG - Intergenic
1142090404 16:88206858-88206880 CCGCGGGGACGGAGGGGGAGGGG + Intergenic
1142090417 16:88206884-88206906 CCGCGGGGACGGAGGGGGAGGGG + Intergenic
1142090489 16:88207034-88207056 CCGCGGGGACGGAGGGGGAGGGG + Intergenic
1142090514 16:88207085-88207107 CCGCGGGGACGGAGGGGGAGGGG + Intergenic
1142156462 16:88534706-88534728 CCCCCGGGACGGCCTCGGCCCGG + Exonic
1142176141 16:88646310-88646332 CCCAGGGGACGTGCGCGGACCGG + Intronic
1142304415 16:89277642-89277664 CCCCGGGGACGGCTGGGGTCAGG + Intronic
1142413118 16:89926158-89926180 CCCCGGGGAGGGAGGAGCACAGG - Intronic
1147612864 17:41811955-41811977 CCCCGCGGACGGAAGGGGACAGG + Exonic
1148493454 17:48037739-48037761 CCCCGGGTGCGGACGTGGCCAGG + Exonic
1148738857 17:49880640-49880662 CTCCGCGGAGGGACCCGGACGGG + Intergenic
1150217084 17:63476922-63476944 CCCCGGGCAGGGGCGCGGGCCGG - Intergenic
1152675206 17:81636712-81636734 CCCTGGGGAGGGACACGGACGGG + Intronic
1154274363 18:12947179-12947201 CCCGGGGGAAGGAAGCGGCCGGG - Intronic
1160725697 19:616930-616952 ACCGGGGGACGCGCGCGGACGGG - Exonic
1161400794 19:4065700-4065722 CCCCGGGGAGGGCGGCGGCCCGG - Intronic
1161401516 19:4067713-4067735 CCGCGGGGCGGGACGGGGACCGG + Intergenic
1161498129 19:4598397-4598419 CCCCGGGGACGCACGCGGTCAGG - Intergenic
1162833009 19:13298774-13298796 CCCCGCGCACGGGCGCGGACGGG - Exonic
1162954261 19:14089823-14089845 CCGCGGGGACAGGCCCGGACGGG - Exonic
1165445968 19:35856856-35856878 CCCGGGGGGCGGACCCGGGCGGG + Intronic
1166387307 19:42389424-42389446 CCCAGGGGAGGGAGGCGGCCAGG + Intronic
924988370 2:289930-289952 ACGCGGGGACGGGCGCAGACGGG - Intergenic
927857626 2:26537307-26537329 CCCTGGGGACTGACACAGACTGG + Intronic
928085991 2:28346796-28346818 TCCAGGGGACGGACGGGTACTGG - Intergenic
929808575 2:45169564-45169586 CCGCGGAGACGGGCGGGGACGGG + Intergenic
931274873 2:60735751-60735773 CCGCGGGGACGGAGGCGGCGAGG + Intergenic
935196676 2:100820370-100820392 CCGCGGGGCCGGGCGCGGACTGG - Exonic
938296468 2:130182326-130182348 CCCCGGGGCTGGAGGCGGCCCGG + Exonic
938460283 2:131492311-131492333 CCCCGGGGCTGGAGGCGGCCCGG - Exonic
941164852 2:162073946-162073968 CCCCGGGGACGTACGTGGCGCGG + Intronic
942985941 2:182142354-182142376 CCATGGGGACGGACGCAGGCTGG + Exonic
943032068 2:182697471-182697493 CCCTGGGGAAGGACTGGGACAGG - Intergenic
947534957 2:230934569-230934591 CCCCGGGGAGGGAGGCGGCCGGG - Intronic
948666125 2:239535876-239535898 CCCCGGGGAGGGAGGCAGAGGGG - Intergenic
1170562680 20:17570311-17570333 GCCCGGGGAGGGACCCGGTCCGG + Intronic
1172771671 20:37385832-37385854 CCCCGGGGACGGACGCGGACAGG + Intronic
1172869319 20:38125939-38125961 CCCCGGGGAGGGAAGCTGCCTGG + Intronic
1173649110 20:44651752-44651774 CCCCGGGAACGGCGGCGGGCGGG - Intronic
1176549983 21:8216952-8216974 CCCCGGGGAGGGGGGAGGACGGG - Intergenic
1176550183 21:8217407-8217429 CCCCGGGGGCGGACCCGGCGGGG - Intergenic
1176568909 21:8399986-8400008 CCCCGGGGAGGGGGGAGGACGGG - Intergenic
1176569111 21:8400445-8400467 CCCCGGGGGCGGACCCGGCGGGG - Intergenic
1176576823 21:8444221-8444243 CCCCGGGGAGGGGGGAGGACGGG - Intergenic
1176577025 21:8444677-8444699 CCCCGGGGGCGGACCCGGCGGGG - Intergenic
1179783755 21:43718617-43718639 CCCTGGGAAGGGACGCGGATCGG + Intergenic
1179923911 21:44522188-44522210 CCTCGGGGAGGGACTTGGACTGG - Intronic
1180190839 21:46161786-46161808 CCCCGGGGACCCAGGCGGGCGGG - Intronic
1183361799 22:37386699-37386721 CCCCGGGGAGGGCCGCCGGCTGG + Intronic
1185048836 22:48543238-48543260 CCCCGGGGAGGGGAGCGGCCTGG - Intronic
1203254873 22_KI270733v1_random:133278-133300 CCCCGGGGAGGGGGGAGGACGGG - Intergenic
1203255078 22_KI270733v1_random:133745-133767 CCCCGGGGGCGGACCCGGCGGGG - Intergenic
1203262929 22_KI270733v1_random:178357-178379 CCCCGGGGAGGGGGGAGGACGGG - Intergenic
1203263134 22_KI270733v1_random:178824-178846 CCCCGGGGGCGGACCCGGCGGGG - Intergenic
950549033 3:13655341-13655363 GCTCGGGGACGGCCGCGGGCGGG - Intergenic
954375864 3:50193917-50193939 CCCCGGGGCAGGACGGGGCCTGG - Intronic
964087609 3:152835838-152835860 CCCCCAGGACGAACCCGGACCGG - Exonic
966807083 3:183816150-183816172 CACCTGGGAGGGACGCTGACAGG + Exonic
968922952 4:3532115-3532137 CCCAGGGGTCGGAGGCGGAGGGG - Intronic
969405179 4:6987018-6987040 CACCGGGGACGCGCGCCGACAGG - Intronic
985995887 5:3596537-3596559 CCCCGGGGACGCAAGAGGGCTGG + Intronic
997980149 5:138463951-138463973 CCCTGGGGCCGAACGCGAACAGG - Intergenic
1001915236 5:175554973-175554995 CCCCGGGAACAGAAGCGGCCAGG + Intergenic
1002060041 5:176620620-176620642 CCCCGGGGTTGGACGCGGGCGGG + Exonic
1002524267 5:179806717-179806739 GCCCGGGGCCGGGCGGGGACCGG + Intronic
1035240767 7:157527819-157527841 CCCCGGCCACGGAGGCAGACAGG + Intergenic
1035286325 7:157809634-157809656 CCCCGAGGACGGAGACGGAACGG + Intronic
1036569090 8:9964121-9964143 CCCAGGAGAAGGACGCAGACCGG - Intergenic
1043390115 8:79784067-79784089 CCCACTGGACGGACGCGGCCCGG + Intergenic
1044698920 8:94949204-94949226 CGGCGGGGAAGGACGCGGGCGGG + Exonic
1045111892 8:98944443-98944465 GCCTGGGGAGGGACGCGGGCGGG + Exonic
1045488626 8:102654217-102654239 CCCCCGGGTCGGGCGCGGGCGGG - Intronic
1051936344 9:22447145-22447167 CGCCGGGGACGGGGGCGGAGGGG - Exonic
1062499893 9:136847776-136847798 CCCCGCGGACCGACGGGGACCGG - Exonic
1203471274 Un_GL000220v1:116423-116445 CCCCGGGGAGGGGGGAGGACGGG - Intergenic
1203471476 Un_GL000220v1:116882-116904 CCCCGGGGGCGGACCCGGCGGGG - Intergenic
1203479095 Un_GL000220v1:160395-160417 CCCCGGGGAGGGGGGAGGACGGG - Intergenic
1203479297 Un_GL000220v1:160854-160876 CCCCGGGGGCGGACCCGGCGGGG - Intergenic
1200116243 X:153770944-153770966 CCCTGGGGAAGGACGCTGTCAGG - Exonic