ID: 1172772722

View in Genome Browser
Species Human (GRCh38)
Location 20:37391077-37391099
Sequence TGCTCGGAGGCCAGCCAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172772722_1172772735 27 Left 1172772722 20:37391077-37391099 CCTGCTTGGCTGGCCTCCGAGCA No data
Right 1172772735 20:37391127-37391149 GGTGGCTGGAGACTCCCCAGAGG No data
1172772722_1172772732 13 Left 1172772722 20:37391077-37391099 CCTGCTTGGCTGGCCTCCGAGCA No data
Right 1172772732 20:37391113-37391135 AGCCTTCCACTCTGGGTGGCTGG No data
1172772722_1172772728 6 Left 1172772722 20:37391077-37391099 CCTGCTTGGCTGGCCTCCGAGCA No data
Right 1172772728 20:37391106-37391128 TCCTGCCAGCCTTCCACTCTGGG No data
1172772722_1172772727 5 Left 1172772722 20:37391077-37391099 CCTGCTTGGCTGGCCTCCGAGCA No data
Right 1172772727 20:37391105-37391127 CTCCTGCCAGCCTTCCACTCTGG No data
1172772722_1172772730 9 Left 1172772722 20:37391077-37391099 CCTGCTTGGCTGGCCTCCGAGCA No data
Right 1172772730 20:37391109-37391131 TGCCAGCCTTCCACTCTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172772722 Original CRISPR TGCTCGGAGGCCAGCCAAGC AGG (reversed) Intronic