ID: 1172772902

View in Genome Browser
Species Human (GRCh38)
Location 20:37392035-37392057
Sequence GTGTACAACAAGGAGGTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 189}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172772889_1172772902 21 Left 1172772889 20:37391991-37392013 CCTTGGGGGTCAGTGGGAGAGAC 0: 1
1: 0
2: 0
3: 27
4: 223
Right 1172772902 20:37392035-37392057 GTGTACAACAAGGAGGTGGGTGG 0: 1
1: 0
2: 2
3: 16
4: 189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172772902 Original CRISPR GTGTACAACAAGGAGGTGGG TGG Intronic
903855987 1:26337775-26337797 GAGTTCAGCAAGGAGGTGGGAGG - Intronic
904995719 1:34629830-34629852 GTTCACAATAAGGAGGTAGGAGG - Intergenic
909478888 1:76112249-76112271 CTGTCCAGGAAGGAGGTGGGGGG - Intronic
909988428 1:82191474-82191496 GATTACAACAAGGAGGATGGTGG - Intergenic
910790195 1:91042804-91042826 GTGTTGAACAAGGATGTGGTGGG - Intergenic
911271264 1:95803998-95804020 CTCTCCAACATGGAGGTGGGAGG - Intergenic
915047247 1:153028600-153028622 GTGTACAACTGGGAAGTGTGGGG - Intergenic
916428869 1:164708549-164708571 GTTTCCAAAAAGGAGGAGGGAGG - Intronic
916970390 1:170007245-170007267 GTGTAAAACAATGAGGGGAGGGG + Intronic
917125015 1:171679336-171679358 CTGTACGACAAGGAGTTGGGAGG - Intergenic
921758024 1:218881905-218881927 GTCTACAAAAAGGAGGAGGCAGG + Intergenic
922035620 1:221845279-221845301 GTGTTCAAAAAGGATGTGGAGGG - Intergenic
922615254 1:226957289-226957311 GTGTGAACCAGGGAGGTGGGGGG - Intronic
1064172630 10:13047581-13047603 GTGTGAAAGAAGGAGGCGGGAGG - Intronic
1067793866 10:49306924-49306946 GGGTGCAACAAGGAGGTGCAAGG + Intronic
1070025863 10:72631416-72631438 TTTTACCACTAGGAGGTGGGAGG + Intergenic
1070965772 10:80529411-80529433 ATGTCCAACAAGGAGGTGGATGG + Exonic
1071522736 10:86341135-86341157 CTGAACAATAAGGAGGAGGGAGG - Intronic
1071711234 10:88051738-88051760 GTGAACAGCATGGGGGTGGGTGG + Intergenic
1072323430 10:94273053-94273075 GTGTCTGTCAAGGAGGTGGGTGG - Intronic
1074872938 10:117591436-117591458 GTGTGTAACAAGGGGTTGGGTGG + Intergenic
1077008215 11:369099-369121 GCGGACAACACGGAGGAGGGAGG - Intergenic
1077071605 11:676428-676450 TTGTACAACATGGAGCTGGGTGG - Intronic
1078187055 11:9060961-9060983 GTCTACAACAAGGCAGTGGTTGG - Intronic
1080942425 11:36934389-36934411 GTGTGCAAAATGGAGGTTGGAGG + Intergenic
1082757288 11:57090692-57090714 TTATGCAACAAGGAGGTGGTGGG + Intergenic
1083045317 11:59729246-59729268 GAGAACCACAATGAGGTGGGAGG - Intronic
1083224814 11:61278203-61278225 GTGTAAAACACGAAGGTTGGTGG - Intronic
1084184614 11:67464965-67464987 GTGTACTGCCGGGAGGTGGGAGG + Intronic
1086170003 11:83825645-83825667 GTGAACAAGATGGAGGTAGGAGG + Intronic
1086805191 11:91232868-91232890 GTGTTCAATAAGGAATTGGGGGG - Intergenic
1087974619 11:104529671-104529693 GTTGACAACAAGGAGGTCTGAGG + Intergenic
1088764496 11:112962583-112962605 GTGAACAATAGGGAGCTGGGAGG + Intronic
1089097574 11:115931884-115931906 GTGTAGAACTAGCAGGTGGTAGG - Intergenic
1090166061 11:124548841-124548863 GTGTTCAGCAAGGTGGTGGAGGG - Intergenic
1090580047 11:128149320-128149342 GTGGCTAACAAGGGGGTGGGAGG + Intergenic
1091243830 11:134074632-134074654 GTGTTCAAAAAGAAGGGGGGAGG - Intronic
1091470255 12:720328-720350 GAGTAAAACAAGGAGGTTGTGGG - Intergenic
1091821321 12:3477415-3477437 CTGTACAGCAAGGAAGGGGGAGG + Intronic
1094635975 12:32227369-32227391 GTGGGAAACAGGGAGGTGGGAGG + Intronic
1094829551 12:34293817-34293839 GTGTGCAACAAGCATATGGGGGG - Intergenic
1098890962 12:76010531-76010553 GTGGAAAAGAAGGAGGTGGCAGG - Intergenic
1100117934 12:91331390-91331412 GTCTACAACACGGAGATGTGGGG - Intergenic
1103921817 12:124403169-124403191 CTGTAAAACGGGGAGGTGGGGGG + Intronic
1103954618 12:124569112-124569134 GGCCAAAACAAGGAGGTGGGGGG - Intergenic
1108198652 13:48020549-48020571 CTTTAAAACAAGGAGTTGGGGGG - Intergenic
1108591547 13:51917118-51917140 GTGTGGGACTAGGAGGTGGGTGG - Intergenic
1109100864 13:58181928-58181950 GAGTATAACAAGGAGTTAGGAGG - Intergenic
1110356152 13:74570153-74570175 GTGTAGATCATGGAGGTAGGAGG + Intergenic
1111615113 13:90652687-90652709 GAAAGCAACAAGGAGGTGGGGGG + Intergenic
1114078292 14:19176684-19176706 GAGTTCTACAGGGAGGTGGGAGG - Intergenic
1115117078 14:29894203-29894225 GTATACACCAAGGAGGTGGGAGG + Intronic
1115199899 14:30841652-30841674 GTGTACATTAAGAAGCTGGGTGG - Intergenic
1119843116 14:77808124-77808146 GAGTTCAACCAGCAGGTGGGTGG + Intronic
1120036941 14:79708606-79708628 GTCTATGACAAGGTGGTGGGAGG + Intronic
1120314831 14:82878201-82878223 GTGTAGAATATGGAGTTGGGTGG + Intergenic
1121009578 14:90512192-90512214 GTGAACAGCAAGGAGGGGGCAGG - Intergenic
1121329167 14:93039266-93039288 CTGTAGAACAAGGAGGTGGGGGG - Intronic
1122943422 14:104993786-104993808 GTGTACACCCAGGAGATGGTGGG + Intronic
1125348162 15:38740544-38740566 GTGTACTGTAAGGAGGTTGGTGG + Intergenic
1125877014 15:43157986-43158008 GGGTACAAAAAAGAGGGGGGAGG - Intronic
1128646487 15:69382307-69382329 GTGAAGTTCAAGGAGGTGGGAGG + Intronic
1132353695 15:101156206-101156228 GTGAGCAGCATGGAGGTGGGTGG + Intergenic
1132473909 16:122865-122887 GCTTCCAGCAAGGAGGTGGGTGG - Intronic
1135163542 16:20118336-20118358 CTATCAAACAAGGAGGTGGGAGG - Intergenic
1135424924 16:22327653-22327675 ATGTACAACACAGAGGTGGCTGG - Intronic
1135935836 16:26779266-26779288 GTTTAAAAAAAGAAGGTGGGGGG + Intergenic
1136532189 16:30877073-30877095 GTGAACAGCAAGGAGGAGAGTGG + Intronic
1140618811 16:76701866-76701888 GTGGACTAGAAGCAGGTGGGAGG - Intergenic
1141433049 16:83980843-83980865 GTGGACACCAAGGAGCTGTGTGG + Exonic
1141650550 16:85390683-85390705 GGGCAGAACAAGGCGGTGGGGGG - Intergenic
1141775696 16:86121544-86121566 AGGAGCAACAAGGAGGTGGGGGG - Intergenic
1142352002 16:89584843-89584865 GTGTACAGGACGGAGGTGAGCGG + Exonic
1142804366 17:2363724-2363746 GTGTGAAACAGGGAGTTGGGAGG - Intronic
1143001332 17:3796993-3797015 GTGTAGAAGATCGAGGTGGGGGG - Intronic
1144645824 17:16972719-16972741 GTGTAAAACAAGGATGAGGTCGG + Intergenic
1147599758 17:41738577-41738599 GTGCACAATTAGGTGGTGGGTGG - Intergenic
1148583561 17:48760645-48760667 GTGAACAGACAGGAGGTGGGTGG + Intergenic
1150978493 17:70115766-70115788 ATTTAAAACAAGGAGGTGGGAGG - Intronic
1152186881 17:78862714-78862736 GGGGAATACAAGGAGGTGGGAGG - Intronic
1152336750 17:79703186-79703208 GGGTACGAGGAGGAGGTGGGGGG - Intergenic
1152863805 17:82710517-82710539 GAGGACAAGAAGGAGGTGGACGG + Intergenic
1155056484 18:22188266-22188288 GTTTAAAACATGGAGGTGGTAGG + Intronic
1158173755 18:54629910-54629932 GTGTACAACTAGGAGGTACAAGG - Intergenic
1158870469 18:61682360-61682382 ATGTACAATAATGAGGTGGGAGG - Intergenic
1160044600 18:75375173-75375195 GTTTAGAACAAAGAGGTGGAAGG - Intergenic
1160554727 18:79717850-79717872 GGGTGGAACAAGGCGGTGGGGGG - Exonic
1160854765 19:1211766-1211788 GTGTCCAGCCAGGAGGTGGGAGG + Intronic
1161489199 19:4552593-4552615 GTGTGCAAGAACGACGTGGGAGG - Exonic
1163483444 19:17572497-17572519 GTGTGCAACAAGGAGGAGTACGG + Exonic
1164474704 19:28566562-28566584 GTTTAGAACACTGAGGTGGGAGG - Intergenic
1165724200 19:38101115-38101137 ATGTACAACAATGAGGAGGCCGG + Exonic
1166788076 19:45381360-45381382 ATGTACAAGAAGGAAGTGGAGGG - Intronic
1167654207 19:50752863-50752885 GTATACAAAAAGGAGGTAGTGGG + Intergenic
1167655903 19:50764004-50764026 GTATACAAAAAGGAGCTGGCGGG + Intergenic
926700221 2:15798463-15798485 GTTTCCATCAAAGAGGTGGGTGG + Intergenic
928257593 2:29737662-29737684 GAATACAACAAGCAGGTGGTAGG + Intronic
928329733 2:30348459-30348481 GTGGACAACATGGCAGTGGGTGG - Intergenic
929423261 2:41816798-41816820 GTGTACAATGAGGAGGTTGTGGG - Intergenic
929446451 2:42005227-42005249 GTGTAGAAGAAGGATGTTGGGGG - Intergenic
930151539 2:48065213-48065235 GTCCACAACAAGGAAGTTGGAGG + Intergenic
935135342 2:100295625-100295647 GTGAACAAGGAGGTGGTGGGTGG + Intronic
935442813 2:103122284-103122306 GCATACAACAGGGAGGTTGGAGG - Intergenic
936149912 2:110010535-110010557 GTGTACAACAAAGAGGTGCCTGG - Intergenic
936194764 2:110360834-110360856 GTGTACAACAAAGAGGTGCCTGG + Intergenic
936225835 2:110650187-110650209 ATGTGTAACAAGGGGGTGGGCGG + Intronic
937713142 2:125001134-125001156 AGGGACAACAAGGAGGTGGTTGG + Intergenic
938015404 2:127863133-127863155 TTGTACAAATTGGAGGTGGGTGG + Exonic
939341009 2:140895925-140895947 GAGTACAGGATGGAGGTGGGGGG + Intronic
940647156 2:156403665-156403687 TTGTACCAGAAGGAGTTGGGTGG - Intergenic
941947795 2:171119354-171119376 GAGAACAAGAAGGTGGTGGGGGG - Intronic
942983867 2:182115486-182115508 GTTTACCACAAGGAGTTGTGAGG + Intronic
943414364 2:187581699-187581721 GTGTACAAGAAGGATTTGAGTGG + Intergenic
943515890 2:188885990-188886012 GTCAACAAGAAGGAGGTAGGAGG + Intergenic
945277806 2:208005919-208005941 GAGTAAAACAACAAGGTGGGTGG - Intronic
945948395 2:216015685-216015707 GTTTACACCAGGGTGGTGGGTGG + Intronic
948118394 2:235510969-235510991 GTTTTCAACAAGGTGCTGGGTGG + Intronic
948417261 2:237819401-237819423 GTGGAGAACCAGGAAGTGGGAGG + Intronic
1169207169 20:3747106-3747128 GTCTAGAGCAAGGAGTTGGGGGG + Intronic
1170337761 20:15289558-15289580 GTGAAGAACAAGGAAGTGGCAGG + Intronic
1171432242 20:25090400-25090422 GTGGACATCAAGAAGGTGAGAGG + Intergenic
1172772902 20:37392035-37392057 GTGTACAACAAGGAGGTGGGTGG + Intronic
1172773708 20:37395646-37395668 GTCTTCAGCAAGGAGGTTGGGGG + Intronic
1174282848 20:49452037-49452059 GAGTACAGCAGGGAGTTGGGAGG + Intronic
1177600663 21:23308076-23308098 GTGTAAAAGAAGGAGGTGAAAGG + Intergenic
1177772245 21:25529864-25529886 GGGAACACCAAGGAGGTTGGTGG - Intergenic
1180582842 22:16857842-16857864 GTGTACAACAAAGAGGTGCCTGG + Intergenic
1181171032 22:21010202-21010224 ATGTACATGAGGGAGGTGGGTGG - Intronic
1181959941 22:26615882-26615904 GTGTCCCAGAAGGAGGAGGGAGG + Intronic
1182325716 22:29511253-29511275 GTGTGCTACAAGGAGCTGTGTGG - Exonic
1182719719 22:32387292-32387314 GTGAACAAAATGGAGGTAGGTGG - Intergenic
950138502 3:10599791-10599813 GTGTTCTATAAGGGGGTGGGGGG + Intronic
950452755 3:13074352-13074374 GTGTGCGACAGGGAGGTGGAGGG + Intergenic
950553775 3:13682898-13682920 GTGTGTGACAAGGAGGTTGGTGG - Intergenic
951509478 3:23485587-23485609 GTGTATATCATGGAGGTGAGAGG + Intronic
951561360 3:23969954-23969976 GTGTACATCAAGGAGGAAGGGGG + Intronic
952760139 3:36906226-36906248 GTAGACATCAAGGAGATGGGAGG + Intronic
956308999 3:67858535-67858557 GAGTAAAGGAAGGAGGTGGGTGG + Intergenic
960939870 3:122926545-122926567 GTGTGCAAGAATGACGTGGGGGG - Exonic
963854457 3:150239233-150239255 GTGGACAGGAAGGAAGTGGGAGG + Intergenic
967664780 3:192158134-192158156 GTGTACAACCATGAGGTTTGGGG - Intronic
968265105 3:197356679-197356701 GTGAAGAACACAGAGGTGGGTGG + Intergenic
970436683 4:16042431-16042453 GTGGAAGACAAGGAGGTGGGAGG + Intronic
972201420 4:36718094-36718116 GTGTTGAACAAGGATGTGGTGGG + Intergenic
973295723 4:48518606-48518628 GTGAACAAGAAGGAGAGGGGTGG - Intronic
974496802 4:62640371-62640393 GGGTGCAACAGGGAGGTGGGAGG - Intergenic
974518448 4:62947210-62947232 ATGGACAACAAAGAGGTAGGAGG - Intergenic
977537742 4:98275843-98275865 GTTTACAGTAAAGAGGTGGGAGG - Intronic
978429701 4:108620718-108620740 GGGCACAACAGGGAGGTTGGTGG + Intronic
978446565 4:108786359-108786381 CTTTAAAACAAGGAGTTGGGGGG - Intergenic
979062229 4:116078305-116078327 CAGTACAACAAAGAAGTGGGAGG - Intergenic
983169753 4:164522121-164522143 GTGTAACACAAGGAGGTGTATGG + Intergenic
986732454 5:10645299-10645321 GTGGATAACATGGGGGTGGGTGG + Intronic
988006239 5:25415567-25415589 GGAAACACCAAGGAGGTGGGTGG - Intergenic
989828901 5:45890794-45890816 CTGTCCAGGAAGGAGGTGGGGGG + Intergenic
990246708 5:53870375-53870397 GTCTACTGCAAGGAGGTGGTGGG + Intergenic
990668070 5:58095807-58095829 TTGTAAAACTAGGAGCTGGGTGG - Intergenic
992739972 5:79763828-79763850 CTCCACAGCAAGGAGGTGGGAGG - Intronic
995847314 5:116508299-116508321 CTGTACATCAAGGGTGTGGGAGG - Intronic
997300165 5:132797902-132797924 GGGTACAACAGGGAGAGGGGAGG + Intronic
1000410136 5:160929221-160929243 GTTTACACCAAGGAGGTAGGAGG - Intergenic
1002019138 5:176351002-176351024 ATGTACAACTAAGAGGAGGGTGG - Intronic
1005512197 6:26521085-26521107 AAGAACAACAAGGGGGTGGGCGG + Intergenic
1006494553 6:34412743-34412765 GTGAACAATACGAAGGTGGGAGG - Intronic
1007108196 6:39297645-39297667 GTCTACACTCAGGAGGTGGGAGG - Intergenic
1007241960 6:40432701-40432723 GTGAACAACAACCAGCTGGGCGG - Exonic
1009059410 6:58380221-58380243 GTGCAGAACAAGCAGATGGGAGG + Intergenic
1009231440 6:61066859-61066881 GTGCAGAACAAGCAGATGGGAGG - Intergenic
1013156109 6:107491578-107491600 ATGGAAAATAAGGAGGTGGGGGG - Intronic
1013165510 6:107587520-107587542 GTGTACAATGAGGACGTAGGAGG - Intronic
1016979761 6:149843482-149843504 GGGTACCAGGAGGAGGTGGGTGG - Intronic
1017113535 6:150954772-150954794 GAATACAAAAATGAGGTGGGAGG - Intronic
1025015636 7:55436892-55436914 TTGTACAGTAAGGAGGAGGGTGG - Intronic
1027522370 7:79225302-79225324 GTGTACAACAAGCATTTGTGGGG - Intronic
1028984363 7:96998226-96998248 GTTTTCAAGAAGGGGGTGGGGGG + Intergenic
1029189608 7:98762248-98762270 CTGTACAGCAAGGAGGTTGCGGG + Intergenic
1031154790 7:118096662-118096684 GGGTAGAATAAGGGGGTGGGAGG + Intergenic
1035607069 8:936728-936750 GGGTACAGCATGGAGGTGGCAGG + Intergenic
1037069930 8:14631622-14631644 ATCTCCAGCAAGGAGGTGGGTGG - Intronic
1039565196 8:38546638-38546660 GAGTTGAAAAAGGAGGTGGGAGG - Intergenic
1044143385 8:88682944-88682966 GTATACAACAGGAAGGTTGGAGG + Intergenic
1047673774 8:127177416-127177438 ATGTAAAACAAAGATGTGGGAGG - Intergenic
1048950681 8:139494230-139494252 GTGTACATCCAGGAAGTTGGGGG + Intergenic
1049773221 8:144393259-144393281 TTGTACAAAAAGGGGGTGGGAGG + Exonic
1049875093 8:145012246-145012268 CTTTAAAACAAGGAGTTGGGGGG + Intergenic
1053141829 9:35687450-35687472 GTGTAGGGAAAGGAGGTGGGGGG + Intronic
1055355311 9:75431584-75431606 GTATACCCCAAGGAGGTGGCTGG + Intergenic
1056489333 9:87089436-87089458 GTGTCCATCTATGAGGTGGGAGG + Intergenic
1057887397 9:98840263-98840285 GTGGATAAAAAGGTGGTGGGGGG - Intronic
1058935295 9:109764304-109764326 ATGTACAAGATGGAGGGGGGTGG - Intronic
1059645549 9:116263218-116263240 GTGGATAAGAAGGAGGTCGGTGG + Intronic
1060230553 9:121822377-121822399 GTGTATCACCAGGAGGTGTGAGG + Exonic
1060832739 9:126727883-126727905 GTTTGCATCAAGGTGGTGGGAGG - Intergenic
1061541765 9:131281309-131281331 ATGTCCACCAGGGAGGTGGGTGG + Intergenic
1062009060 9:134257347-134257369 GTGCACAACGGGGAGCTGGGTGG + Intergenic
1062365887 9:136208885-136208907 GGGGCCCACAAGGAGGTGGGCGG - Exonic
1062663936 9:137656640-137656662 GTGTACACCCAGGAGGCAGGGGG + Intronic
1187298293 X:18024003-18024025 TTATTTAACAAGGAGGTGGGTGG - Intergenic
1187733403 X:22279657-22279679 GTGCTCTAAAAGGAGGTGGGAGG - Intergenic
1187889525 X:23921146-23921168 GTGTACAGCAAGGGGGTGGCAGG - Intronic
1188060998 X:25601961-25601983 GAATACAACAGGGAGGAGGGAGG - Intergenic
1188488493 X:30710102-30710124 GTGTAAAACAAGGGGATAGGAGG - Intronic
1189169672 X:38897028-38897050 GTGAGAGACAAGGAGGTGGGCGG + Intergenic
1189213775 X:39306063-39306085 GTGGACCACAGGGATGTGGGAGG + Intergenic
1189267039 X:39725181-39725203 GTGTACAAAGGGGATGTGGGGGG - Intergenic
1191836619 X:65470205-65470227 GTGGAGAAAAAGGAGGTGGAGGG + Intronic
1194938155 X:99976739-99976761 GTGGACTACTAGAAGGTGGGGGG + Intergenic
1198432763 X:136584419-136584441 GGGTATAAGAAGAAGGTGGGGGG - Intergenic