ID: 1172774969

View in Genome Browser
Species Human (GRCh38)
Location 20:37402030-37402052
Sequence CGACCAGGAGTGACGAGGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 97}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172774965_1172774969 6 Left 1172774965 20:37402001-37402023 CCTTTTTTTTTTTCATTTAATCC 0: 1
1: 1
2: 22
3: 375
4: 3328
Right 1172774969 20:37402030-37402052 CGACCAGGAGTGACGAGGATTGG 0: 1
1: 0
2: 1
3: 7
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172774969 Original CRISPR CGACCAGGAGTGACGAGGAT TGG Intronic
900551120 1:3256107-3256129 TAACCAGGAGGGACGAGGAGAGG + Intronic
904329704 1:29750492-29750514 CGATCAGGAGTGACCAGGAGTGG - Intergenic
905354454 1:37371780-37371802 AGACCAGGAGTGATGGGGGTTGG + Intergenic
907503634 1:54901825-54901847 AGACCAGGTGTGAGGAGGAGAGG + Intergenic
914852694 1:151326927-151326949 CGACGAGGAAGGACAAGGATGGG + Intronic
921462494 1:215445222-215445244 CCACCAGGAGTGACCAGGGTAGG + Intergenic
924428948 1:243979706-243979728 CGGCCAGGAGTGGGGGGGATGGG + Intergenic
1062906619 10:1183853-1183875 AGGCCAGGAGGGAAGAGGATGGG + Intronic
1068230903 10:54168508-54168530 CGACCAGGTGTGAGGAGGGGAGG - Intronic
1068592412 10:58864976-58864998 CGACCAGGTGTGAGGAGGGGAGG + Intergenic
1071125062 10:82324312-82324334 CTATCAAGAGTGACGAGGGTAGG - Intronic
1076059926 10:127405796-127405818 TGACCAGGAGTGACCAGGACAGG - Intronic
1078682872 11:13496443-13496465 TGACCAGAAGTGACATGGATTGG - Intergenic
1081625893 11:44654873-44654895 CAACCAGGAGTAACAAGCATAGG + Intergenic
1082059579 11:47848652-47848674 CGACCAGGAGGGGCGAGGTCCGG + Intergenic
1083771209 11:64868653-64868675 GGACCAGGAGTGACTATGAGGGG + Intronic
1085183143 11:74553042-74553064 CAAACAGGAGAGACGAGGGTTGG + Intronic
1086356381 11:86005402-86005424 CGACAAAGAGTGAGGAGGCTGGG + Intronic
1089609030 11:119659311-119659333 CAACCAGGAGTGGGTAGGATTGG + Intronic
1090387230 11:126364273-126364295 GGACCAGGAGACACCAGGATGGG + Intronic
1090389794 11:126381471-126381493 GGACCAGGAGACACCAGGATGGG + Intronic
1095698446 12:45165924-45165946 CGCCCAGGAGTGACATGGAATGG - Intergenic
1097194391 12:57235698-57235720 GGACCAGGAGATAAGAGGATGGG + Intronic
1104140550 12:125983243-125983265 GCACCAGGAGAGACCAGGATTGG - Intergenic
1104719187 12:131035177-131035199 CGACCAGGAGCGACCAGGAAGGG - Intronic
1107092329 13:36495373-36495395 AGACCAGGAGTGTTGAGGAGGGG + Intergenic
1107683213 13:42871372-42871394 CGACCAGGTGTGAGGAGGGGAGG + Intergenic
1108512922 13:51171620-51171642 CGACCAGGTGTGAGGAGGGGAGG - Intergenic
1108803946 13:54131675-54131697 TGACCAGGTGTGAGGAGGAGAGG + Intergenic
1108814058 13:54268610-54268632 CGACCAGGTGTGAGGAGGGGAGG - Intergenic
1109716818 13:66230333-66230355 CGACCAGGTGTGAGGAGGGGAGG + Intergenic
1111458912 13:88516782-88516804 CGACCAGGTGTGAGGAGGGGAGG + Intergenic
1111631776 13:90852545-90852567 CGACCAGGTGTGAGGAGGGGAGG + Intergenic
1115077349 14:29408035-29408057 CGAATAGGAGTGGCGAGGATGGG - Intergenic
1115240667 14:31249262-31249284 CGACCAGGTGTGAGGAGGGGAGG + Intergenic
1122040926 14:98986953-98986975 GGACCAGGTGTGAGGAGGGTAGG - Intergenic
1132799059 16:1742571-1742593 TGAACAGGAGTAATGAGGATGGG + Intronic
1133293875 16:4740541-4740563 CGACCAGCAGTGACAAAGGTGGG + Exonic
1143178220 17:4968570-4968592 CGACCAGGAGGGACGAGGAGAGG + Exonic
1143583886 17:7841940-7841962 CCACCAGGCGTGATGAGGACGGG + Intronic
1146019672 17:29266834-29266856 ATACCAGGACTGGCGAGGATGGG - Intronic
1146574455 17:33979108-33979130 TGACCAGGAGAGAGGAGGGTGGG + Intronic
1152291220 17:79441207-79441229 GGAGCAGGTGTGACGAGGGTGGG + Intronic
1153269566 18:3306522-3306544 GGATCAGGAGGGACAAGGATAGG - Intergenic
1156252004 18:35360306-35360328 GGACCAGGTGTGAGGAGGAGAGG + Intergenic
1156489428 18:37487496-37487518 TGACCAGGAGGGAGGAGGACGGG - Intronic
1157272508 18:46287287-46287309 GGAACAGGAGTGGTGAGGATAGG + Intergenic
1159164395 18:64683385-64683407 CGACCAGGTGTGAGGAGGGGAGG - Intergenic
1160012484 18:75116587-75116609 CAGCCATGAGTGACAAGGATGGG - Intergenic
1162386301 19:10362251-10362273 CAACCAGGAGGTACGATGATAGG - Exonic
1163210894 19:15839384-15839406 AGACCAGGGGTGACGAGGCAGGG + Intergenic
1164579093 19:29423274-29423296 GGGCCTGGAGTGAGGAGGATTGG - Intergenic
1164647579 19:29870991-29871013 CCACCAGCAATGACCAGGATAGG + Intergenic
1167606874 19:50485896-50485918 AGACCAGAAGTCACGAGGCTAGG - Exonic
1168481469 19:56723848-56723870 CCACCAGGAGTGAGGAGTAAGGG + Intergenic
926413523 2:12628257-12628279 GGACCAGGTGTGAGGAGGAGAGG - Intergenic
926464159 2:13167944-13167966 GGACCAGGTGTGAGGAGGAGAGG + Intergenic
926540812 2:14178869-14178891 CGAGCAGGAGTCAGGAGGTTGGG - Intergenic
930099193 2:47589999-47590021 AGACCAGGTGTGAGGAGGAGAGG + Intergenic
931220824 2:60286396-60286418 TGACCTGGAGTGAGGCGGATGGG - Intergenic
932295783 2:70622374-70622396 CGACCAGGTGTGAGGAGGGGTGG - Intronic
932660722 2:73649284-73649306 AGACCAGGAGAGAAGGGGATAGG - Intergenic
942835217 2:180287264-180287286 TGACCAGGAGTAAAGAGCATAGG - Intergenic
948542217 2:238699107-238699129 AGACCAGGAGCGAAGAGGGTAGG - Intergenic
1172774969 20:37402030-37402052 CGACCAGGAGTGACGAGGATTGG + Intronic
1172938035 20:38634641-38634663 AGACTTGGCGTGACGAGGATAGG + Exonic
1173527311 20:43743048-43743070 AGCCCAGGAGTGGCCAGGATGGG - Intergenic
1174949727 20:55030493-55030515 CCAGCAGGAGTGAAGATGATAGG + Intergenic
1182417004 22:30227835-30227857 AGACCAGGAGTGAGGAGGCTTGG + Intergenic
950926426 3:16746072-16746094 GGACCAGGTGTGACGAGGGGAGG - Intergenic
952520270 3:34149978-34150000 CATCCAGGAGAGACCAGGATGGG - Intergenic
954197566 3:49005657-49005679 GGACCAGGACAGACTAGGATGGG - Intronic
957057891 3:75458264-75458286 TGACTAGGAGTGACTAGGAATGG - Intergenic
961295563 3:125881447-125881469 TGACTAGGAGTGACTAGGAATGG + Intergenic
961890348 3:130125725-130125747 TGACTAGGAGTGACTAGGAATGG - Intergenic
969001758 4:3988271-3988293 TGACTAGGAGTGACTAGGAATGG - Intergenic
969812156 4:9656540-9656562 TGACTAGGAGTGACTAGGAATGG + Intergenic
971999344 4:34009751-34009773 TGGCCAGGAATGATGAGGATAGG + Intergenic
975846688 4:78532615-78532637 TTACCAGGAGCGACGAGGAGGGG - Intronic
977010244 4:91625842-91625864 AGACCAGGTGTGAGGAGGGTAGG - Intergenic
977757046 4:100684105-100684127 TGAACAGGAGTGATGAGAATTGG - Intronic
986388807 5:7265337-7265359 CGACCAGGTGTGAGGAGGGGAGG - Intergenic
986905704 5:12491588-12491610 CGACCAGGTGTGAGGAGGGGAGG - Intergenic
998693779 5:144615339-144615361 CGACCAGGTGTGAGGAGGGGAGG + Intergenic
1003430240 6:6031741-6031763 CGACCAGGTGTGAGGAGGGGAGG + Intergenic
1007246308 6:40465759-40465781 ATACCAGGAGTGAGGAGGGTGGG + Intronic
1010059868 6:71610391-71610413 CGACCAGGATGGAAGAGGAGAGG - Intergenic
1011238531 6:85245046-85245068 CAACCAGGAGTGAAGAGGCAAGG + Intergenic
1011771016 6:90674171-90674193 GGACCAGGTGTGAGGAGGAGAGG + Intergenic
1012066616 6:94557905-94557927 GGACCAGGTGTGAGGAGGAGAGG + Intergenic
1014001561 6:116371039-116371061 CGCCCTGGAGTGAGGAGGACCGG + Exonic
1014228100 6:118871579-118871601 TGAACAGGAGTGACGAGAGTGGG - Intronic
1018070637 6:160161499-160161521 AGAGCAGGAGTGACGGCGATGGG + Intergenic
1018868040 6:167760515-167760537 CGACGAGCAGTGTGGAGGATGGG - Intergenic
1026912075 7:74096834-74096856 AGACCAGGAGAGACAATGATGGG - Intronic
1034445243 7:151110774-151110796 CCACCAGGACTGACACGGATTGG + Intronic
1044347407 8:91121128-91121150 GGACCTGGAGAGACGTGGATGGG - Intronic
1046236864 8:111435491-111435513 TGAACAGGAGTGATGAGGATAGG + Intergenic
1047730730 8:127725995-127726017 GGAGCAAGGGTGACGAGGATGGG - Intergenic
1047773242 8:128047476-128047498 CCACCAGGTCTGAAGAGGATGGG + Intergenic
1049273279 8:141707435-141707457 AAACCAGGAGTGACGTGGACAGG - Intergenic
1051849362 9:21489661-21489683 CGACCAGGTGTGAGGAGGGGAGG + Intergenic
1055242599 9:74202167-74202189 AGACAAGGAGTGATAAGGATTGG + Intergenic
1195291234 X:103433523-103433545 CGACCAGGTGTGAGGAGGGGAGG + Intergenic
1195908751 X:109869173-109869195 CGACCAGGTGTGAGGAGGGGAGG + Intergenic
1199296221 X:146161819-146161841 AGACCAGGAGTGAGGAAGAGTGG - Intergenic