ID: 1172776966

View in Genome Browser
Species Human (GRCh38)
Location 20:37413524-37413546
Sequence TGATGGGTGTGGGGCCCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172776966_1172776981 8 Left 1172776966 20:37413524-37413546 CCTCCTGGGCCCCACACCCATCA No data
Right 1172776981 20:37413555-37413577 CAAACCCTTCAAGGCCCGTTGGG No data
1172776966_1172776974 -1 Left 1172776966 20:37413524-37413546 CCTCCTGGGCCCCACACCCATCA No data
Right 1172776974 20:37413546-37413568 ACCCGGCCCCAAACCCTTCAAGG No data
1172776966_1172776987 25 Left 1172776966 20:37413524-37413546 CCTCCTGGGCCCCACACCCATCA No data
Right 1172776987 20:37413572-37413594 GTTGGGCTTGGCATCCTGTTTGG No data
1172776966_1172776980 7 Left 1172776966 20:37413524-37413546 CCTCCTGGGCCCCACACCCATCA No data
Right 1172776980 20:37413554-37413576 CCAAACCCTTCAAGGCCCGTTGG No data
1172776966_1172776984 13 Left 1172776966 20:37413524-37413546 CCTCCTGGGCCCCACACCCATCA No data
Right 1172776984 20:37413560-37413582 CCTTCAAGGCCCGTTGGGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172776966 Original CRISPR TGATGGGTGTGGGGCCCAGG AGG (reversed) Intergenic
No off target data available for this crispr