ID: 1172779073

View in Genome Browser
Species Human (GRCh38)
Location 20:37425087-37425109
Sequence CTGGGTAAAGGGGAGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172779073_1172779087 21 Left 1172779073 20:37425087-37425109 CCCTCCTCCTCCCCTTTACCCAG No data
Right 1172779087 20:37425131-37425153 CCTTCCTGTCACCCCACAAGTGG No data
1172779073_1172779088 22 Left 1172779073 20:37425087-37425109 CCCTCCTCCTCCCCTTTACCCAG No data
Right 1172779088 20:37425132-37425154 CTTCCTGTCACCCCACAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172779073 Original CRISPR CTGGGTAAAGGGGAGGAGGA GGG (reversed) Intergenic
No off target data available for this crispr