ID: 1172780026

View in Genome Browser
Species Human (GRCh38)
Location 20:37431087-37431109
Sequence TACCAAAGACAGCTGAGGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172780026_1172780028 -8 Left 1172780026 20:37431087-37431109 CCAATCCTCAGCTGTCTTTGGTA No data
Right 1172780028 20:37431102-37431124 CTTTGGTATCACAAACTCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172780026 Original CRISPR TACCAAAGACAGCTGAGGAT TGG (reversed) Intergenic
No off target data available for this crispr