ID: 1172780028

View in Genome Browser
Species Human (GRCh38)
Location 20:37431102-37431124
Sequence CTTTGGTATCACAAACTCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172780023_1172780028 22 Left 1172780023 20:37431057-37431079 CCCTCATGCTCACAAGTTGGATA No data
Right 1172780028 20:37431102-37431124 CTTTGGTATCACAAACTCAGTGG No data
1172780021_1172780028 30 Left 1172780021 20:37431049-37431071 CCAGGTTGCCCTCATGCTCACAA No data
Right 1172780028 20:37431102-37431124 CTTTGGTATCACAAACTCAGTGG No data
1172780024_1172780028 21 Left 1172780024 20:37431058-37431080 CCTCATGCTCACAAGTTGGATAC No data
Right 1172780028 20:37431102-37431124 CTTTGGTATCACAAACTCAGTGG No data
1172780026_1172780028 -8 Left 1172780026 20:37431087-37431109 CCAATCCTCAGCTGTCTTTGGTA No data
Right 1172780028 20:37431102-37431124 CTTTGGTATCACAAACTCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172780028 Original CRISPR CTTTGGTATCACAAACTCAG TGG Intergenic
No off target data available for this crispr