ID: 1172780632

View in Genome Browser
Species Human (GRCh38)
Location 20:37435000-37435022
Sequence ATGGGTACACGGTGGGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172780632_1172780640 6 Left 1172780632 20:37435000-37435022 CCTCCCACCCACCGTGTACCCAT No data
Right 1172780640 20:37435029-37435051 AAACGCACTGAGCCTGTTCCAGG No data
1172780632_1172780641 12 Left 1172780632 20:37435000-37435022 CCTCCCACCCACCGTGTACCCAT No data
Right 1172780641 20:37435035-37435057 ACTGAGCCTGTTCCAGGAACTGG No data
1172780632_1172780644 25 Left 1172780632 20:37435000-37435022 CCTCCCACCCACCGTGTACCCAT No data
Right 1172780644 20:37435048-37435070 CAGGAACTGGTGTTCAAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172780632 Original CRISPR ATGGGTACACGGTGGGTGGG AGG (reversed) Intergenic
No off target data available for this crispr