ID: 1172781662

View in Genome Browser
Species Human (GRCh38)
Location 20:37440101-37440123
Sequence AAGCAAACAGCAGAGGTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172781662_1172781668 27 Left 1172781662 20:37440101-37440123 CCTGCCACCTCTGCTGTTTGCTT No data
Right 1172781668 20:37440151-37440173 GCTGCGTCGTAGCGCTCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172781662 Original CRISPR AAGCAAACAGCAGAGGTGGC AGG (reversed) Intergenic
No off target data available for this crispr