ID: 1172782913

View in Genome Browser
Species Human (GRCh38)
Location 20:37447783-37447805
Sequence CAGAGGAAACAGGAGAAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172782913_1172782925 23 Left 1172782913 20:37447783-37447805 CCACCCTTCTCCTGTTTCCTCTG No data
Right 1172782925 20:37447829-37447851 CCTCTGTGTCCATGTCCCCAGGG No data
1172782913_1172782923 22 Left 1172782913 20:37447783-37447805 CCACCCTTCTCCTGTTTCCTCTG No data
Right 1172782923 20:37447828-37447850 CCCTCTGTGTCCATGTCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172782913 Original CRISPR CAGAGGAAACAGGAGAAGGG TGG (reversed) Intergenic
No off target data available for this crispr