ID: 1172785339

View in Genome Browser
Species Human (GRCh38)
Location 20:37464801-37464823
Sequence GTGTCCTGGGTGAACTTTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172785339_1172785347 20 Left 1172785339 20:37464801-37464823 CCCACAAAGTTCACCCAGGACAC No data
Right 1172785347 20:37464844-37464866 AGGACTTAATGAGCTCACCTTGG No data
1172785339_1172785346 0 Left 1172785339 20:37464801-37464823 CCCACAAAGTTCACCCAGGACAC No data
Right 1172785346 20:37464824-37464846 GGGGATAAAGTTACACACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172785339 Original CRISPR GTGTCCTGGGTGAACTTTGT GGG (reversed) Intergenic
No off target data available for this crispr