ID: 1172786102

View in Genome Browser
Species Human (GRCh38)
Location 20:37469818-37469840
Sequence GCTTACACCCCAAGTAGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172786102_1172786112 27 Left 1172786102 20:37469818-37469840 CCCACCCTACTTGGGGTGTAAGC No data
Right 1172786112 20:37469868-37469890 GCCTCAGTCCCCAGAGCAGGTGG No data
1172786102_1172786110 24 Left 1172786102 20:37469818-37469840 CCCACCCTACTTGGGGTGTAAGC No data
Right 1172786110 20:37469865-37469887 TCCGCCTCAGTCCCCAGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172786102 Original CRISPR GCTTACACCCCAAGTAGGGT GGG (reversed) Intergenic
No off target data available for this crispr