ID: 1172786602

View in Genome Browser
Species Human (GRCh38)
Location 20:37472916-37472938
Sequence GAAGGTGGCAGGGATGGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172786594_1172786602 11 Left 1172786594 20:37472882-37472904 CCAAAGCAGCAAGAGTTGAGGGT No data
Right 1172786602 20:37472916-37472938 GAAGGTGGCAGGGATGGTGCTGG No data
1172786589_1172786602 18 Left 1172786589 20:37472875-37472897 CCACTCCCCAAAGCAGCAAGAGT No data
Right 1172786602 20:37472916-37472938 GAAGGTGGCAGGGATGGTGCTGG No data
1172786592_1172786602 12 Left 1172786592 20:37472881-37472903 CCCAAAGCAGCAAGAGTTGAGGG No data
Right 1172786602 20:37472916-37472938 GAAGGTGGCAGGGATGGTGCTGG No data
1172786590_1172786602 13 Left 1172786590 20:37472880-37472902 CCCCAAAGCAGCAAGAGTTGAGG No data
Right 1172786602 20:37472916-37472938 GAAGGTGGCAGGGATGGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172786602 Original CRISPR GAAGGTGGCAGGGATGGTGC TGG Intergenic
No off target data available for this crispr