ID: 1172789167

View in Genome Browser
Species Human (GRCh38)
Location 20:37490679-37490701
Sequence CCTTGGCAGGAACTGTTTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172789167_1172789176 10 Left 1172789167 20:37490679-37490701 CCCCAAAACAGTTCCTGCCAAGG No data
Right 1172789176 20:37490712-37490734 CCCCCGATTGCTGGATTCAAAGG No data
1172789167_1172789174 1 Left 1172789167 20:37490679-37490701 CCCCAAAACAGTTCCTGCCAAGG No data
Right 1172789174 20:37490703-37490725 TCATAGGAGCCCCCGATTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172789167 Original CRISPR CCTTGGCAGGAACTGTTTTG GGG (reversed) Intergenic
No off target data available for this crispr