ID: 1172789669

View in Genome Browser
Species Human (GRCh38)
Location 20:37494245-37494267
Sequence TCATGACCACAAAGAGATCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 91}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172789669_1172789671 0 Left 1172789669 20:37494245-37494267 CCTCGATCTCTTTGTGGTCATGA 0: 1
1: 0
2: 0
3: 7
4: 91
Right 1172789671 20:37494268-37494290 ACCTGAGAGGTGTGAAACATTGG 0: 1
1: 0
2: 0
3: 12
4: 145
1172789669_1172789673 23 Left 1172789669 20:37494245-37494267 CCTCGATCTCTTTGTGGTCATGA 0: 1
1: 0
2: 0
3: 7
4: 91
Right 1172789673 20:37494291-37494313 CAGTCACGAACGCCAGTGTGTGG 0: 1
1: 0
2: 0
3: 1
4: 53
1172789669_1172789674 29 Left 1172789669 20:37494245-37494267 CCTCGATCTCTTTGTGGTCATGA 0: 1
1: 0
2: 0
3: 7
4: 91
Right 1172789674 20:37494297-37494319 CGAACGCCAGTGTGTGGAAGAGG 0: 1
1: 0
2: 1
3: 3
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172789669 Original CRISPR TCATGACCACAAAGAGATCG AGG (reversed) Intronic
900100867 1:961410-961432 TCATGGCCACGAAGGCATCGTGG - Exonic
902096301 1:13948663-13948685 TCATGGCCACAAAGAGGTCTTGG - Intergenic
902412722 1:16220872-16220894 TCATCACCACACAGAGCTGGGGG + Intergenic
902848166 1:19128940-19128962 TCATGACCTGACAGAGATCCAGG + Intronic
905043431 1:34978047-34978069 TTTTGACCACAAAGAGGTCCTGG + Intergenic
911132731 1:94406859-94406881 TGATGAACACAAAGAGAAAGAGG - Intergenic
917479290 1:175396989-175397011 TCATGACCTTATAGAGATTGGGG - Intronic
918471455 1:184880017-184880039 TCATGAACACAAAGAAAGAGAGG - Intronic
922300722 1:224297647-224297669 TGATGAACACAAAGAGAAAGAGG + Intronic
1066179146 10:32942838-32942860 TCATGCCCACCTAGAGATCCTGG + Intronic
1083245146 11:61421072-61421094 TAATGACCACCAAGAGTTCAAGG + Intronic
1086589525 11:88495603-88495625 TCATGAAAACAAAGAAATAGTGG - Intergenic
1087890435 11:103531703-103531725 TCAGGACCAGAAAGAGGTCCTGG + Intergenic
1090614376 11:128501785-128501807 TCTTGACCACAAATATATCATGG + Intronic
1093587937 12:20864306-20864328 TCATGTTCTCAAAGAGATGGTGG - Intronic
1093601134 12:21024698-21024720 TCATGTTCTCAAAGAGATGGTGG - Intronic
1099062188 12:77925585-77925607 ACATGACCACTAAGAGAGCATGG - Intronic
1110707038 13:78608363-78608385 TCATGTCCACGGAGAGATCAGGG - Intergenic
1112313863 13:98343845-98343867 TCCTGATCACAAAAAGATCACGG + Exonic
1112498062 13:99920949-99920971 TCATGAGGTCAAGGAGATCGAGG - Intergenic
1112777713 13:102863641-102863663 AAATGACCACAAAGACATTGCGG - Intronic
1118702215 14:68444655-68444677 GAATGACCACAAAGTGATCAGGG + Intronic
1130080980 15:80733198-80733220 TCATGACCATGAGGAGGTCGGGG - Intronic
1131084024 15:89560253-89560275 TCCTTACCACAGAGAGATGGAGG - Intergenic
1131204463 15:90430133-90430155 CCATGACCAAAAACAGATCCAGG - Intronic
1133834807 16:9358464-9358486 CCATAACCACAAAGAAATCATGG - Intergenic
1135422081 16:22312124-22312146 TCATCACCACAAAAAGAACCAGG - Intronic
1137965552 16:52929155-52929177 ACCCAACCACAAAGAGATCGTGG + Intergenic
1138421212 16:56900437-56900459 TGATGATCAAAAAGAGATCAGGG + Intronic
1139972230 16:70783360-70783382 TCATGCCCACAGAGAGGCCGCGG - Intronic
1145078788 17:19877125-19877147 TCATGAGCACCCAGAGATCAGGG + Intergenic
1148771537 17:50070144-50070166 TCAGGACCAGAAAGAGATAATGG + Intronic
1149827355 17:59841510-59841532 TCATGACCACAAATAAATAAAGG + Intronic
1155739722 18:29273252-29273274 TCCTGAGGACAAAGAGATCTTGG + Intergenic
1157272292 18:46285405-46285427 TCATGACCACACAGAGAGCATGG - Intergenic
1159236378 18:65679443-65679465 CAATGAACACAAAGAGATTGAGG - Intergenic
1162519313 19:11170095-11170117 GCACGGCCACAAGGAGATCGCGG - Exonic
1165637714 19:37356535-37356557 TTACAACCACAAAGAGATCTTGG - Intronic
1166924995 19:46261114-46261136 CCTTGACCACAGAGAGATTGAGG - Intergenic
1167263971 19:48474261-48474283 TCATGGCCACAAAGCGCTCCAGG - Exonic
1168339637 19:55615652-55615674 TCATGACGTGAAAGAGATCCGGG - Exonic
925547065 2:5028217-5028239 CCATGAGCACAATGAGATTGGGG + Intergenic
927392265 2:22608901-22608923 TCATGAACACTTAGAGATTGTGG + Intergenic
929899956 2:45992380-45992402 TCATCACCAGAAAGAGATTTTGG - Intronic
930705722 2:54502965-54502987 TCATGACCACAGAGGGAACATGG - Intronic
934793440 2:97082077-97082099 TGATGACTTCAAAGAGACCGAGG + Intergenic
936619154 2:114076930-114076952 TCAGGAACACAAAAAGATGGGGG + Intergenic
937955761 2:127421012-127421034 TCAAGGTCACACAGAGATCGGGG + Intronic
1172789669 20:37494245-37494267 TCATGACCACAAAGAGATCGAGG - Intronic
1172922021 20:38491501-38491523 TCTTGTCCACAAGGAGATCCTGG + Intronic
1175149400 20:56921336-56921358 TAATGACCTCAAAGACATCCAGG - Intergenic
949922459 3:9013762-9013784 TCATGACCACAATGACCACGCGG + Exonic
950956745 3:17061968-17061990 TCATTATCACAAAGAAATTGCGG + Intronic
951709913 3:25576941-25576963 TATTGACCACAAAGAGATGTTGG + Intronic
953705800 3:45229308-45229330 GGAGGACCACAAAGAGATCATGG - Intergenic
955522676 3:59790342-59790364 TCAAGACCACTAAGAGGTAGAGG + Intronic
960260215 3:115559007-115559029 TCAAGACCAGAAAGAGATTTAGG + Intergenic
963921780 3:150912496-150912518 TAAGGAACAAAAAGAGATCGGGG - Intronic
965054889 3:163699240-163699262 TCTTGACCACAAAGGGGTCCGGG + Intergenic
966690006 3:182732274-182732296 TAATGACCTCAAAGATATCCAGG + Intergenic
969189392 4:5504879-5504901 TCATGACCACAAAGAGTGAGTGG - Intergenic
969349992 4:6592943-6592965 TCAGGACCCCAAAGAGGCCGGGG - Intronic
969725072 4:8913913-8913935 CCATGTCCACAGAGAGAACGTGG + Intergenic
970284983 4:14502034-14502056 TCATGACAACAAAGACAACATGG - Intergenic
971176386 4:24286424-24286446 TCATGACCACAAAGATCTGAGGG + Intergenic
973705837 4:53579432-53579454 TTAGGACCAAAAAGAGATGGGGG - Intronic
974152638 4:58028989-58029011 TCATTCCCACAAAGTGATTGTGG - Intergenic
974904482 4:68038186-68038208 CCATGATCACAAAGAGAGGGAGG - Intergenic
999633148 5:153592405-153592427 TCAAAACCACAAAGAGACCACGG - Intronic
999830102 5:155310769-155310791 TCTTGCCCAGAAAGAGATCTTGG + Intergenic
1003392735 6:5727516-5727538 TCCTGACCACATGGAGACCGCGG - Intronic
1004989798 6:21124633-21124655 CCATTGCCACAAAGAGAACGAGG - Intronic
1004989801 6:21124656-21124678 CAATGGCCACAAAGAGAACGAGG + Intronic
1011258221 6:85445732-85445754 CTATGGCCACAAAGAGATCACGG + Intergenic
1011346603 6:86376443-86376465 TCAGGACCACAGAGAGATAGAGG - Intergenic
1012028468 6:94028354-94028376 TCATGACAAGAAAGAGATTTGGG - Intergenic
1014497476 6:122143775-122143797 ACATCATCACAAAGAGATGGAGG + Intergenic
1014967451 6:127773551-127773573 TCATGACAACAAAAAGATTGTGG + Intronic
1015385610 6:132619711-132619733 ACCTGACCAAAAAGAGATCCAGG + Intronic
1015749398 6:136544925-136544947 TCTTTACCCCAAAGAGATGGGGG - Intronic
1022575432 7:31492720-31492742 TCATGACAACATAGAGAGCTTGG - Intergenic
1025094840 7:56088863-56088885 TTATGAGCCCAAAGAGATCCTGG - Exonic
1032451643 7:132036791-132036813 TCATGAGCACAGAGAGGTGGGGG - Intergenic
1032641663 7:133776184-133776206 TCGTGACAATAAAGAGATGGTGG - Intronic
1033129441 7:138733360-138733382 TCATGCCCACACAGAGAGGGTGG + Intronic
1037350744 8:17952429-17952451 ACATGACCACACAGAGGTCTTGG - Intronic
1041744151 8:61188374-61188396 TAATGACCACAAAGATAGCCAGG + Intronic
1042043175 8:64617124-64617146 TCATCACCTCAAAGAGACCTTGG - Intronic
1042139963 8:65668060-65668082 TCATGACCAGAAACAGTTTGTGG - Intronic
1044632031 8:94289459-94289481 TCATGACCAGAAAGAGTTTGAGG + Intergenic
1052251683 9:26406044-26406066 TCATGAACACAAAGTGAAGGGGG + Intergenic
1055931549 9:81564614-81564636 TCATGACCACATAGAGTCCCTGG - Intergenic
1056827665 9:89887951-89887973 TCATTACCACAAAGAAATCCAGG - Intergenic
1057289018 9:93788576-93788598 TCATGACCACCAACACATGGGGG + Intergenic
1057774355 9:97994174-97994196 TCAAGACCACTAAGAGATTCTGG - Intronic
1058006699 9:99923759-99923781 TCAAGCCCAAAAAGGGATCGTGG - Intronic
1186386604 X:9116324-9116346 TGGGGACCACAAAGAGATTGTGG + Intronic
1189173637 X:38932791-38932813 TCATTACCAAAAAGAGAACCAGG - Intergenic
1192683192 X:73275186-73275208 TGATGACAAGAAAGAGATTGTGG + Intergenic