ID: 1172793930

View in Genome Browser
Species Human (GRCh38)
Location 20:37524310-37524332
Sequence AAACCCAGTATTGGGGAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 245
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 220}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172793930_1172793936 12 Left 1172793930 20:37524310-37524332 CCTCTCTCCCCAATACTGGGTTT 0: 1
1: 0
2: 1
3: 23
4: 220
Right 1172793936 20:37524345-37524367 GCACCAGCCTCCGTATTCTTAGG 0: 1
1: 0
2: 0
3: 3
4: 64
1172793930_1172793940 25 Left 1172793930 20:37524310-37524332 CCTCTCTCCCCAATACTGGGTTT 0: 1
1: 0
2: 1
3: 23
4: 220
Right 1172793940 20:37524358-37524380 TATTCTTAGGAATGCTTACCAGG 0: 1
1: 0
2: 0
3: 23
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172793930 Original CRISPR AAACCCAGTATTGGGGAGAG AGG (reversed) Intronic
900242187 1:1622378-1622400 AAGCCCAGCATGGTGGAGAGAGG + Intronic
901463374 1:9404898-9404920 ACACCCAGCATTTGGGAGGGTGG - Intergenic
903293992 1:22332188-22332210 AAGCCCAGGACTGGGGAGAGAGG - Intergenic
903919112 1:26787230-26787252 AAACCGTCTATTGGGGGGAGCGG - Intergenic
904454824 1:30641346-30641368 GAACCCAGTACTGGGGACAGGGG - Intergenic
904752013 1:32746852-32746874 AAAACCAGTTTTGGGGAAAGGGG + Intronic
906118504 1:43371595-43371617 AAACTCAGGAAGGGGGAGAGGGG - Intergenic
907591344 1:55675203-55675225 AAACTCAGAAGTGGGGAGGGTGG - Intergenic
908534541 1:65066332-65066354 AGAAACATTATTGGGGAGAGGGG - Intergenic
909329783 1:74397167-74397189 AAACCGAGTATGAGGGAGAAAGG + Intronic
909921429 1:81385574-81385596 AAACATTGTTTTGGGGAGAGTGG + Intronic
910811381 1:91240813-91240835 AAACCCAATATTCAGGAGAGGGG - Intergenic
911503869 1:98724268-98724290 AAACCCAGCAATGGCCAGAGTGG - Intronic
911880072 1:103225676-103225698 AACCCCAATATTGGAGATAGAGG + Intergenic
917348283 1:174051397-174051419 AAACCCTAAATTGGAGAGAGGGG - Intergenic
918388292 1:184033234-184033256 AAACCTATGATTAGGGAGAGTGG - Intronic
919319694 1:196020115-196020137 GAAACCAGTATTTGGGACAGTGG + Intergenic
919331751 1:196181052-196181074 CTACACAGGATTGGGGAGAGTGG + Intergenic
919687320 1:200496235-200496257 AATCCCACTATTTGGGAGACTGG - Intergenic
919947201 1:202328319-202328341 AAACCCTGTATTGGGGTGGGAGG + Intergenic
922023739 1:221731228-221731250 AAAACCAGTATAAGGGACAGGGG - Intronic
1063538934 10:6912369-6912391 AAAGCCAGTATTCTGGAAAGAGG + Intergenic
1064792586 10:18974872-18974894 AAACCCAGTAATGGGATGGGTGG - Intergenic
1068167015 10:53343295-53343317 AAAGCCAGCATTGTAGAGAGAGG - Intergenic
1068481457 10:57593760-57593782 AAACACAGTATTGAGAAGTGGGG - Intergenic
1068636527 10:59354262-59354284 AAAGCCAGGAAAGGGGAGAGGGG + Intronic
1069784091 10:70977052-70977074 AAACTCAGAAATGGGGAGAGAGG + Intergenic
1070373891 10:75810449-75810471 ACACCCAATATTGGGCATAGTGG + Intronic
1072011707 10:91307552-91307574 AAACCAAGTATGGGAAAGAGTGG - Intergenic
1072342317 10:94464837-94464859 AAAACAAGTAGTGGGGAGAGTGG + Intronic
1072367467 10:94727679-94727701 ACTCCCAGTAATGTGGAGAGTGG - Intronic
1073468896 10:103710707-103710729 CGTCCCAGTATTGGGGTGAGAGG + Intronic
1073976468 10:109107486-109107508 AAACCCTGTACTGAGGAGAGAGG + Intergenic
1075242648 10:120792745-120792767 CAGCCCAGTGTTGGGGGGAGGGG - Intergenic
1075935057 10:126333322-126333344 AACCCCAGTAATGGGGAGGATGG + Intronic
1077225970 11:1439337-1439359 AAACCCAGGGTTGGGGTGTGGGG + Intronic
1080801842 11:35617586-35617608 CAACCTCGTGTTGGGGAGAGGGG - Intergenic
1083143892 11:60743526-60743548 AAGCCCAGCATCAGGGAGAGAGG + Intronic
1083242037 11:61395890-61395912 ACACCCAGTATTAGGGTGTGGGG + Intronic
1083887186 11:65578602-65578624 CAGCCCAGTTTTGGGGACAGAGG - Intronic
1089779787 11:120865662-120865684 AAACTCAGTGTTAGGGAGTGAGG + Intronic
1090974204 11:131667888-131667910 AAACCCAGCAGTGGGAAGAGAGG - Intronic
1093611532 12:21165580-21165602 ATACACAATTTTGGGGAGAGGGG - Intronic
1095386284 12:41654417-41654439 AAACCAAGTATTTAGGAGATTGG - Intergenic
1095501848 12:42848214-42848236 TAGCCCAGTATGGGAGAGAGGGG - Intergenic
1096102406 12:48978019-48978041 ACACTCAGGATGGGGGAGAGAGG + Intergenic
1096748543 12:53744305-53744327 CAACCCAGGATTGGGTAGAAAGG - Intergenic
1096897222 12:54834899-54834921 AAACTCAGAATGGAGGAGAGTGG - Intronic
1098196176 12:68004399-68004421 AGATCCAGCATTGGGAAGAGAGG - Intergenic
1100738773 12:97567695-97567717 AAAGTCAGCAATGGGGAGAGTGG - Intergenic
1100999417 12:100342908-100342930 ATACCCAGTAATGGGATGAGTGG - Intergenic
1101250236 12:102926862-102926884 GAACACAGAATTGGGAAGAGAGG - Intronic
1103478598 12:121236354-121236376 CAAGCCAGTGTTGGGGTGAGGGG + Intergenic
1104959702 12:132482822-132482844 AAAGCCAGGAGTGGGGCGAGTGG + Intergenic
1105697908 13:22908670-22908692 GAACCAGGTAATGGGGAGAGAGG - Intergenic
1106226631 13:27791424-27791446 AAGCCGGGTCTTGGGGAGAGCGG + Intergenic
1106860070 13:33895998-33896020 AGACTCAGAATGGGGGAGAGTGG + Intronic
1106919680 13:34550191-34550213 AAAAGCAGAATTGGGCAGAGGGG - Intergenic
1107470722 13:40688752-40688774 AAATCCAGAATTGGGGTAAGTGG - Intergenic
1108746629 13:53402010-53402032 AAACGCAGCAATGGTGAGAGGGG - Intergenic
1109683058 13:65778219-65778241 AAACCAATTATTGGGGAATGGGG + Intergenic
1110092571 13:71471299-71471321 AAAGGCAGGCTTGGGGAGAGGGG + Intronic
1110233704 13:73194193-73194215 AAACTCACCATTAGGGAGAGTGG - Intergenic
1110325172 13:74205740-74205762 AAACTCATTACTGGGTAGAGAGG + Intergenic
1111503641 13:89158422-89158444 AAAGACAGGGTTGGGGAGAGAGG - Intergenic
1114439003 14:22731161-22731183 AAAAAAAGAATTGGGGAGAGAGG - Intergenic
1114752780 14:25224319-25224341 AAACCCAGAAATGGGGAATGAGG + Intergenic
1116801172 14:49444540-49444562 AGACTCAGAAGTGGGGAGAGTGG - Intergenic
1120260539 14:82178885-82178907 AAAATAATTATTGGGGAGAGCGG - Intergenic
1121155011 14:91674981-91675003 AAAGCCAGCAGTTGGGAGAGTGG - Intronic
1127332757 15:57954966-57954988 ATACCAAATATTGGGGAAAGTGG - Exonic
1127836750 15:62796636-62796658 AAACCCTGTTTTGGGAAGATAGG + Intronic
1128502001 15:68233192-68233214 TAACACTGTATTGGGGAGTGTGG - Intronic
1129530927 15:76263922-76263944 TCACCCAGTAAGGGGGAGAGAGG - Intronic
1131826909 15:96329731-96329753 ACACCCAGTCATGGTGAGAGGGG - Intronic
1133667091 16:7979206-7979228 AAAAACAGTGTTGGGGGGAGAGG + Intergenic
1134817538 16:17218323-17218345 AAACTCAGGGGTGGGGAGAGGGG + Intronic
1135270772 16:21067746-21067768 AAAGCCAGTCTTGGGGGGGGGGG + Intronic
1136076172 16:27818931-27818953 AAACCCAGTATTGGAGAAACGGG - Intronic
1137945300 16:52728329-52728351 AAATACACTATTTGGGAGAGAGG + Intergenic
1141377638 16:83546667-83546689 AGACCCAGTGGTGTGGAGAGAGG + Intronic
1142383717 16:89748935-89748957 AAACACAGTATAGGGGAGGTGGG - Intronic
1144443913 17:15309036-15309058 AAGCCTAGGGTTGGGGAGAGAGG - Intronic
1144750875 17:17647230-17647252 AAACCCAAGATTGAAGAGAGGGG + Intergenic
1147160261 17:38565611-38565633 AAATCAGGAATTGGGGAGAGAGG - Intronic
1147210766 17:38871195-38871217 AAGTCCAGCATTGGGGAGACAGG - Intronic
1147723142 17:42550917-42550939 AAAACCAGTATTGGGAAAAATGG - Exonic
1147724354 17:42557143-42557165 AAAACCAGTATTGGGAAAAATGG - Intergenic
1148226253 17:45899860-45899882 AAACCCTGGATTGGGGGAAGAGG - Intronic
1148604037 17:48915423-48915445 CAACCAAGTATTAGGGGGAGGGG - Intronic
1148813663 17:50311526-50311548 AAACCAAGCAATGGGAAGAGAGG + Intergenic
1148944864 17:51252324-51252346 AGAACCAGTATTGGGGAGGGGGG - Intronic
1151153774 17:72110232-72110254 AAACCCTGATTAGGGGAGAGGGG + Intergenic
1153130795 18:1853700-1853722 AAAGCCAGCTTTGGGGGGAGGGG + Intergenic
1155054999 18:22174624-22174646 CAAGCCAGTATTGGGGTGAAGGG + Intronic
1156663385 18:39375785-39375807 AAACCCAGTCACAGGGAGAGGGG - Intergenic
1157414485 18:47490528-47490550 AAACCAAGGATTGGGAACAGAGG - Intergenic
1157987295 18:52452605-52452627 AAACCCAGTATTGGCAACAACGG - Intronic
1158161492 18:54489675-54489697 AAACCCAGTTTATGGGGGAGGGG - Intergenic
1158462252 18:57656719-57656741 AAATAAAGTAGTGGGGAGAGAGG + Intronic
1158581897 18:58691171-58691193 AAGATCAGTAGTGGGGAGAGGGG - Intronic
1159471264 18:68859933-68859955 ATACCCAGTATTGGGATGACTGG - Intronic
1161620887 19:5296522-5296544 AAACACAGGATAGGAGAGAGGGG + Intronic
1164484680 19:28644766-28644788 AAACCATGTAATTGGGAGAGGGG + Intergenic
1164913335 19:32029734-32029756 AAAACCAGTTTAAGGGAGAGGGG + Intergenic
1165238933 19:34447971-34447993 AATCCCATTAAGGGGGAGAGTGG + Intronic
1165240220 19:34460651-34460673 ATACTCAGTATTGCAGAGAGTGG + Intronic
1165633568 19:37321773-37321795 CCACCCAGGATCGGGGAGAGAGG + Intronic
1166543770 19:43622502-43622524 AAAGCCAGGAATGGGGAGAGGGG + Exonic
1167337510 19:48896062-48896084 AAACCCGGGATTGCGGAGACGGG - Intronic
1168380249 19:55914129-55914151 AAACCCAGGAATGGGGAGAATGG - Intronic
926911281 2:17853662-17853684 AAACCTAGCATGGGGGACAGGGG - Intergenic
927251229 2:20996536-20996558 AAGCCCATTCTTGGGGTGAGAGG - Intergenic
929300605 2:40299833-40299855 AAACCGATTAGTAGGGAGAGAGG - Intronic
929605371 2:43230549-43230571 AAAGCCAGAAAAGGGGAGAGGGG + Intergenic
931378658 2:61731777-61731799 ACACCCAGTCCTAGGGAGAGTGG + Intergenic
933201035 2:79449107-79449129 AAACCCCTTTTTGGGGGGAGTGG - Intronic
934892037 2:98079119-98079141 AAAATCAGTATTGAGGAGTGGGG - Intergenic
934943506 2:98519748-98519770 ACACCCTGTGTTGGGGAGTGGGG + Intronic
935432446 2:102990683-102990705 AAAGCCAGTTTTGTGGGGAGAGG + Intergenic
935680953 2:105636443-105636465 AACCCCACTGTTGGGGAGTGAGG - Intergenic
938103573 2:128514376-128514398 AAACCCTGCTTTGTGGAGAGGGG - Intergenic
940088253 2:149886197-149886219 GAACACAGCATGGGGGAGAGTGG - Intergenic
940862968 2:158789250-158789272 AATCCCAGTGTTTTGGAGAGAGG + Intergenic
940943733 2:159592946-159592968 GAACTCAGTGTTGGGGTGAGAGG - Intronic
944177857 2:196853440-196853462 AAAGCTAGTATTGGGAACAGAGG - Intronic
945111594 2:206365588-206365610 ATACCTAGTCTTGGAGAGAGTGG - Intergenic
946740892 2:222800249-222800271 AAGCTCTGCATTGGGGAGAGGGG - Intergenic
947038247 2:225885086-225885108 AAACCCAACATAGGGAAGAGGGG - Intergenic
948562307 2:238862549-238862571 AACCCCAGTATTGAGGAAGGTGG + Intronic
948912539 2:241011699-241011721 GACCCCAGTGCTGGGGAGAGAGG + Intronic
1169424347 20:5484742-5484764 ACCCCCAGTGTGGGGGAGAGAGG - Intergenic
1171971909 20:31569974-31569996 AAACCCAGGAATGGGCAGAATGG - Exonic
1172409695 20:34711879-34711901 AAACCTAGAGTTGGGGTGAGGGG - Exonic
1172793930 20:37524310-37524332 AAACCCAGTATTGGGGAGAGAGG - Intronic
1173801858 20:45899059-45899081 AATCCCTGTGTTGGGGAGAGGGG + Exonic
1174692335 20:52518794-52518816 AAACCCAGTAATGGGTTGAATGG + Intergenic
1180063235 21:45397880-45397902 AAACCCAGTACTGCAGAGAAAGG - Intergenic
1181763408 22:25073684-25073706 AAACCCAGAATGGGGCAGAGGGG - Intronic
1182751982 22:32649110-32649132 AAGCCCAGAATTAGGGATAGGGG - Intronic
1183231282 22:36583722-36583744 GAGCCCAGGATGGGGGAGAGGGG - Intronic
1183232729 22:36593055-36593077 TAACCCAGCCTTGGGGAGCGAGG + Intronic
1183437165 22:37802827-37802849 GAAGCCAGAATTGGGGAAAGGGG - Intergenic
1184018950 22:41807766-41807788 AATCCCAGTATTTGGGAGGCTGG + Intronic
1184524180 22:45011993-45012015 AAACCCAGAAGTGGGAGGAGTGG - Intergenic
1184714479 22:46273134-46273156 AAACCCAGTCATGGGGAGCCAGG + Intronic
950479164 3:13234074-13234096 AAACCCAGCATTGGAGAGCTAGG - Intergenic
952681590 3:36099651-36099673 ATACCCAGTAATGGGGTGACTGG - Intergenic
953820352 3:46202865-46202887 AAACCCAGTAGTGGTGACTGTGG - Exonic
958992262 3:100860605-100860627 GAACCAAGCATTGGGGAGTGGGG - Intronic
959078734 3:101778668-101778690 TAACCCAGAATTGGGGATGGTGG + Intergenic
962630017 3:137266026-137266048 AAACCCTTTACTGAGGAGAGTGG + Intergenic
963048700 3:141124138-141124160 AAACCCAGTGTTCGGGAGAGAGG - Intronic
965477342 3:169173389-169173411 ATTACCAGCATTGGGGAGAGAGG - Intronic
967179224 3:186888747-186888769 TAACCCAGTTATGGGCAGAGGGG + Intergenic
971503434 4:27341173-27341195 GAACCCAGGAGTGGGGAAAGTGG + Intergenic
972780487 4:42282909-42282931 CAGCCCAGGATTAGGGAGAGAGG + Intergenic
980747636 4:137040299-137040321 AAACTCAGAATGGGGGAGGGTGG - Intergenic
981575691 4:146202736-146202758 AAACCCAGGATGGAGGAGACAGG - Intergenic
982037981 4:151365315-151365337 AGACTCAGAATGGGGGAGAGTGG - Intergenic
982982741 4:162161969-162161991 AAAGCCTGGATTGGGTAGAGGGG - Intronic
985740492 5:1613088-1613110 AATGCCAGTGTTGGGGAGAATGG + Intergenic
986102182 5:4623143-4623165 AAACCCTGGAGTGGGGAGGGGGG + Intergenic
986716757 5:10530332-10530354 AAGCCCAGGAGTGAGGAGAGAGG + Intergenic
987422406 5:17736022-17736044 GAGCACAGTCTTGGGGAGAGAGG + Intergenic
990527050 5:56638422-56638444 AAACCCATTGGTGGGCAGAGCGG - Intergenic
991169085 5:63599996-63600018 ATACCCAGTAATGGGATGAGTGG + Intergenic
995929705 5:117424873-117424895 AATCTCAGTTTTGGGGATAGAGG + Intergenic
997467268 5:134096471-134096493 AATCCCAGTCTTGGGGAAGGGGG + Intergenic
1000116368 5:158157538-158157560 AAAACCAGCATTTGGGGGAGGGG + Intergenic
1003926291 6:10881046-10881068 ATTCCCAGTCTTGGGGAGAGCGG - Intronic
1007647645 6:43395337-43395359 AAACCCAATACAGGCGAGAGAGG + Intergenic
1009487115 6:64238543-64238565 AGACTCAGAAGTGGGGAGAGTGG - Intronic
1014179404 6:118368307-118368329 AAACCCATGAATGGTGAGAGTGG - Intergenic
1015146173 6:129990303-129990325 ATACCCAGTATTGGTGATGGTGG + Intergenic
1015348523 6:132189067-132189089 AACCACAGTATGTGGGAGAGAGG - Intergenic
1015532461 6:134234622-134234644 AATCCCAGTATTTGGGAGGCCGG + Intronic
1016658296 6:146544786-146544808 AAACACTGTATTGAGGAGTGGGG - Intronic
1018513226 6:164549446-164549468 ATACCCAGTATTGGGGATGCAGG + Intergenic
1019143075 6:169960601-169960623 AATCCCAGTGCTGGTGAGAGTGG + Intergenic
1022327712 7:29347136-29347158 CAGCCCAGTGTTGGTGAGAGAGG + Intronic
1024238772 7:47417448-47417470 AAGCCCAGTAGTGGTCAGAGGGG + Intronic
1024242296 7:47445014-47445036 AACCTCTGTATTGGGAAGAGGGG + Intronic
1024791512 7:52969869-52969891 AAATGCAGTATTGGGGAGCCTGG + Intergenic
1025971010 7:66325492-66325514 AAACCCTGTCTTGGGGGGAGGGG - Intronic
1026266877 7:68802983-68803005 ATACCCAGTCATGGGGAGAGAGG + Intergenic
1027146001 7:75695197-75695219 AAACTCATTTTTAGGGAGAGTGG + Intronic
1028246099 7:88479014-88479036 AAACCCAGGATTCAGGAGTGAGG + Intergenic
1028500623 7:91515258-91515280 AAAAGCAGCATTGGGGAAAGGGG - Intergenic
1028625006 7:92868247-92868269 AAACACAGAATTGGGGTTAGTGG - Intergenic
1029116612 7:98241021-98241043 ATACCCTGTACTGGGGAGAAGGG - Intronic
1029453811 7:100657001-100657023 TAAAGCAGGATTGGGGAGAGAGG + Intergenic
1029935013 7:104415376-104415398 AAAATCAGTATTGGGGAAAGGGG - Intronic
1030975323 7:116114903-116114925 CCCCCCAGTAATGGGGAGAGAGG + Intronic
1031533426 7:122904673-122904695 ATACCAAGTATTGGTGAGAATGG + Intergenic
1032466913 7:132151805-132151827 GAACCCAGAATGGAGGAGAGAGG + Intronic
1032526092 7:132579008-132579030 AATCCCAGTCTTGCAGAGAGAGG - Intronic
1034433027 7:151050381-151050403 CATCCCAGTCCTGGGGAGAGGGG + Intronic
1037166015 8:15829809-15829831 ATACCCAGTAGTGGGGAGGCTGG + Intergenic
1038612093 8:29067222-29067244 AAACCCTATGTTGGGGTGAGGGG + Intergenic
1038895119 8:31774120-31774142 AAAGCCAGCAAAGGGGAGAGTGG - Intronic
1038953129 8:32437590-32437612 AAAACAAGCATTAGGGAGAGTGG + Intronic
1040831630 8:51683477-51683499 TTACCTAATATTGGGGAGAGGGG + Intronic
1040994803 8:53390846-53390868 AACCCCAGCATTGGAGAGAGTGG - Intergenic
1045648667 8:104323441-104323463 AAAGCCAGTGTTGGGGATGGTGG + Intergenic
1047483928 8:125311243-125311265 TCATCCAGTATTGAGGAGAGTGG - Intronic
1047968239 8:130063418-130063440 AAAGCCAGGAGTGCGGAGAGAGG - Intronic
1048175945 8:132152985-132153007 AAAATGAGTATTGGAGAGAGAGG + Intronic
1048848302 8:138620361-138620383 CAGCCCATTATTGGGGAGTGGGG + Intronic
1049343421 8:142126026-142126048 ATTCCCAGTCTTGGGGAGAGAGG - Intergenic
1049913924 9:297806-297828 AAACCTAGTATGAGGAAGAGAGG + Intronic
1050263767 9:3868920-3868942 TAACCCAAAATTGGGGAGAAAGG - Intronic
1050891458 9:10829721-10829743 AAAGAGAGTATTGGAGAGAGTGG + Intergenic
1051114361 9:13677062-13677084 AGATCCAGTATTGGAGAGGGGGG - Intergenic
1052362273 9:27573663-27573685 AGAGCAAGTAGTGGGGAGAGAGG + Intronic
1052613404 9:30805891-30805913 CATCCAAGTGTTGGGGAGAGGGG - Intergenic
1052658086 9:31391103-31391125 AAATGCAGTATTAGAGAGAGAGG + Intergenic
1053526972 9:38840345-38840367 AGGCCCAGTCTTGGGGAGTGGGG - Intergenic
1054199199 9:62064776-62064798 AGGCCCAGTCTTGGGGAGTGGGG - Intergenic
1054639157 9:67523581-67523603 AGGCCCAGTCTTGGGGAGTGGGG + Intergenic
1055311765 9:74990113-74990135 AAACCTATGATTGGTGAGAGGGG + Intronic
1056918225 9:90762974-90762996 AAAACCAGGAGGGGGGAGAGGGG + Intergenic
1059016862 9:110527856-110527878 AGACTCAGAAGTGGGGAGAGTGG - Intronic
1059458194 9:114412906-114412928 AAACCCGGAATTGGGCTGAGGGG - Intronic
1060380477 9:123165509-123165531 CACCCCAGTACTGAGGAGAGAGG + Intronic
1060973815 9:127753711-127753733 AAACCCTGGAAAGGGGAGAGTGG + Intronic
1061252745 9:129436286-129436308 GAGCCCAGCATGGGGGAGAGAGG + Intergenic
1185764943 X:2717640-2717662 AAACCCAGTGCTGGTGAGAAGGG + Exonic
1187249256 X:17582185-17582207 AAACCCAGCATTGGAGAAATGGG + Intronic
1187282124 X:17865425-17865447 AAACCCAGGTTTAGGGAAAGAGG + Intergenic
1188145656 X:26609111-26609133 TAACTCAGTATTGAGGAGACTGG + Intergenic
1189192904 X:39126306-39126328 ATATCCAGTGTTGGGGAGAGTGG + Intergenic
1189237490 X:39498522-39498544 AAACACATTATTGGGGAAATTGG + Intergenic
1189681131 X:43517822-43517844 AGATCCAGGGTTGGGGAGAGAGG + Intergenic
1189775008 X:44462689-44462711 AAACCTAGAGATGGGGAGAGAGG - Intergenic
1191712247 X:64162443-64162465 AAACCCAGTATTGGAGGCTGGGG - Intergenic
1193566568 X:83084180-83084202 ATACCCAGTAATGGGATGAGTGG + Intergenic
1195031972 X:100935238-100935260 AACCCCTTTATTTGGGAGAGGGG + Intergenic
1196289553 X:113923033-113923055 AATACAGGTATTGGGGAGAGAGG - Intergenic
1196904277 X:120416694-120416716 AAGCCTAGTGTTGAGGAGAGAGG - Intergenic
1197027588 X:121773515-121773537 AGACTCAGAAGTGGGGAGAGAGG - Intergenic
1198023526 X:132682471-132682493 AATCCCAGAATTGGGAAGAGGGG + Intronic
1198963752 X:142207380-142207402 ACACCCAGCATCGGGGAGGGGGG + Intergenic
1199748796 X:150794858-150794880 AAAACTTGTATTGAGGAGAGCGG - Intronic
1200737851 Y:6819481-6819503 ATACCCAGTATTGGGATCAGTGG - Intergenic