ID: 1172794412

View in Genome Browser
Species Human (GRCh38)
Location 20:37527306-37527328
Sequence GGTCTCCTGAGGCTCCGCTT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 115}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172794412 Original CRISPR GGTCTCCTGAGGCTCCGCTT CGG (reversed) Intronic
900612726 1:3551173-3551195 AGACACCAGAGGCTCCGCTTGGG + Intronic
901839923 1:11947784-11947806 GGTCTCCTGAGTCTCCTCCAGGG - Intronic
902975861 1:20088045-20088067 TGTCTCTTTAGGCTCCTCTTGGG - Intronic
904097708 1:27994475-27994497 GATCTCCTGAGGTCCCGCCTCGG + Intronic
904672834 1:32179299-32179321 GGTCTCCTGAGTCTCAGCCCAGG + Intergenic
906750256 1:48252368-48252390 GGTCTCCTGACTTTCAGCTTAGG - Intergenic
907936691 1:59048147-59048169 GGTCTCCTGTGGCTCCCTGTTGG + Intergenic
915762027 1:158323894-158323916 GGTCCCCTCAGGATCTGCTTTGG + Intergenic
919433740 1:197531222-197531244 GGTCTTCTGAGGCTGCTCTAGGG + Intronic
920569505 1:207005929-207005951 CATCTCCTGAGACTCTGCTTTGG - Intergenic
920684242 1:208096909-208096931 GGTCTCCTGAGGCATTTCTTTGG - Intronic
921425559 1:214997385-214997407 GTTCACCTGAGGATCAGCTTGGG - Intergenic
922985316 1:229861805-229861827 AGGCTCCAGAGGCTCCCCTTGGG + Intergenic
1063203194 10:3805730-3805752 GGTCTTCTGATTCTCAGCTTGGG - Intergenic
1064271820 10:13872218-13872240 GGTCTCCTGTGGCTCTGGATGGG + Intronic
1070984958 10:80680794-80680816 TGTCTCCTTAGGCTCCTCCTGGG + Intergenic
1072950940 10:99846286-99846308 GTTCTCCTGAGGAGCCGCTGCGG - Intronic
1076444041 10:130499887-130499909 GGTATCCTGAGGCTCTGTCTGGG + Intergenic
1077035865 11:494216-494238 GGGCTCCTGAGGCTCCGGGGTGG + Intergenic
1081585016 11:44378284-44378306 GGTCTGCTGGGGCTCAGCTGGGG + Intergenic
1085799975 11:79580384-79580406 TTTCTCCTGAGCCTCTGCTTTGG - Intergenic
1085914432 11:80868277-80868299 GTTCTCCTGAGGCACCTCCTCGG + Intergenic
1089563170 11:119356103-119356125 GGTCTACTGTGGCTGTGCTTGGG + Exonic
1091626003 12:2121533-2121555 GGTGTCTTGTGGCTCGGCTTGGG + Intronic
1102014648 12:109639755-109639777 GGTCACCTGAGGCTCCACTTTGG - Intergenic
1102569983 12:113821517-113821539 GGTCACCTGAGGGTCGGCCTGGG + Intronic
1104327875 12:127817411-127817433 CGTCTCCTTAGGCTCTTCTTTGG - Intergenic
1112703517 13:102039348-102039370 GGTCTCCTGGGGCTCCTGTAAGG + Intronic
1113796900 13:113063606-113063628 GGTCTCCTGAGGTTTAGCTCAGG + Intronic
1122042348 14:98997822-98997844 GGTCTCCTGAGTCCCAGGTTTGG - Intergenic
1122544559 14:102514989-102515011 GGTCTCTCAAGGCTCAGCTTTGG + Intergenic
1122717844 14:103706114-103706136 GGTCTCCTGAGCCTCCGTGTCGG - Intronic
1122719232 14:103712894-103712916 CGGCTCCTGAGGCTCCTCCTGGG + Intronic
1127312336 15:57763459-57763481 GGTCTCTTGTCGCTCCACTTAGG - Intronic
1128895197 15:71366499-71366521 GTTCTTCTGAGGCTCCTCCTGGG + Intronic
1129660462 15:77550263-77550285 AATCTCTTGAGGCTCCACTTGGG + Intergenic
1130399481 15:83536216-83536238 GCTGTCCTCAGGCTCGGCTTTGG - Intronic
1131420013 15:92297548-92297570 AGTCTCTTGAGGCTCAGCTTGGG - Intergenic
1132228966 15:100167776-100167798 GGTCTTGTGAGGCTCTCCTTAGG + Intronic
1137776920 16:51063039-51063061 GGTCTCCTGAGTCTTAGCTCCGG + Intergenic
1138233645 16:55360670-55360692 GATGTCCTGAGTCTCAGCTTAGG + Intergenic
1138651644 16:58464325-58464347 GCTCTCCTGCCGCTCCGCTCCGG + Exonic
1139636364 16:68260718-68260740 GGTCCCCTGAGGCCCCCCTAGGG + Exonic
1143397398 17:6612114-6612136 GGTCTCCGGAAGCTCCGTATCGG + Exonic
1146126205 17:30233455-30233477 GGTCTCCTGGGGATCCCCTCAGG - Intronic
1146160548 17:30557187-30557209 TGTCTCCTCAGGATCCTCTTGGG - Exonic
1149577867 17:57726905-57726927 GGTCTCCTGAGCCTGGGGTTTGG + Intergenic
1150300883 17:64045994-64046016 GGGCTCCAGAGGCTCCTGTTGGG + Intronic
1151682602 17:75629747-75629769 GGGCTCCGGGGGCTCAGCTTGGG + Exonic
1155194154 18:23457387-23457409 CGTCTCCTTAAGCTCCTCTTAGG - Intronic
1155965804 18:32034221-32034243 GGTCTCCTTAGACTTGGCTTTGG + Intronic
1157299350 18:46468194-46468216 GGTTTCAGGAGGCTCCCCTTGGG + Intergenic
1160335127 18:78031772-78031794 GGTCTCCTGGGGCCCAGCTGGGG - Intergenic
1161482292 19:4517144-4517166 AGCCTCCTGTGGCTCAGCTTGGG - Intronic
1161874984 19:6901401-6901423 GGTCTCTTGAGGCCCAGGTTTGG + Intronic
1162810843 19:13163674-13163696 TGTTTCCTGAGGCTCAGCCTAGG + Intergenic
1163977312 19:20864485-20864507 GGTCTCCTGAAGCTTCGGTGTGG - Intergenic
927121448 2:19967980-19968002 TGTCTCCTTAGGCTCCTCTGGGG + Intronic
929078596 2:38099090-38099112 GGGCTCTGGAGGCACCGCTTTGG + Intronic
929948872 2:46390976-46390998 CGTCTCCTTAGGCTTCTCTTAGG + Intergenic
931228457 2:60353573-60353595 GGTTTCCTGAGCCTCAGCTGGGG - Intergenic
932046999 2:68359569-68359591 TGTCTCCTTAGGCTTCTCTTGGG + Intergenic
932651778 2:73565890-73565912 TGTCTCCTTAGGCTTCTCTTAGG - Intronic
937943482 2:127309613-127309635 TGTCCCCTGAGGCTCCTCTTAGG + Intronic
938562965 2:132490782-132490804 GGTCCCTGGAGGCTCCTCTTTGG - Intronic
940558717 2:155266265-155266287 GGTCTCCTGAGGATCAGCTGTGG - Intergenic
946161298 2:217837604-217837626 GGTGCCCTGAGTCTCCGCTTTGG + Intronic
1171250738 20:23645143-23645165 GGTCTCCTGAGGCACATCTGGGG + Intergenic
1172480228 20:35267208-35267230 GGGCTCCAGAGGCTCGGCTGGGG - Exonic
1172512350 20:35509322-35509344 GGGCTCATGGGGCTCTGCTTAGG + Intronic
1172794412 20:37527306-37527328 GGTCTCCTGAGGCTCCGCTTCGG - Intronic
1173752507 20:45488169-45488191 GATCTCCTGACGCACCGCCTTGG + Intergenic
1177176834 21:17708611-17708633 GATCTCCTGAGGCTGTCCTTAGG + Intergenic
1180742665 22:18064653-18064675 TGTACCCTGAGGCTCCCCTTGGG - Intergenic
1180834079 22:18921111-18921133 GGTGTCTTAAGGCTCCGCGTGGG + Intronic
1181870058 22:25891025-25891047 GGTCTCCTAAGGCTTGGCCTTGG + Intronic
1183342136 22:37287275-37287297 GGGCTCCTGAAGCTCCTCCTAGG - Intronic
1203284167 22_KI270734v1_random:146409-146431 GGTGTCTTAAGGCTCCGCGTGGG + Intergenic
950421170 3:12900832-12900854 GGGCTCCTGGGGCTCCGGTTGGG + Intronic
950852489 3:16075865-16075887 GGTCTCCTGAGTCTCAGCACAGG - Intergenic
957707809 3:83813057-83813079 GGTCTCCTCAGGATCTGCTGTGG + Intergenic
960724456 3:120656173-120656195 TGTCTTGTGAGGCTCCTCTTTGG - Intronic
961714179 3:128847498-128847520 GCTCTCCTGAGGCCCCACTAAGG - Intergenic
967284071 3:187851508-187851530 GGTCTCCTGAGTCTCAGCCCAGG - Intergenic
968502391 4:957007-957029 GGCCAGCTGAGGCTCCCCTTGGG + Intronic
968980588 4:3847273-3847295 TGTCACCTGAGTCTCAGCTTTGG + Intergenic
985378830 4:189371140-189371162 TGTCTCCTGTGGCTCTGCTCTGG + Intergenic
996410933 5:123158085-123158107 GGTCTTCTGAGGCACCGAATAGG - Intronic
997694765 5:135852232-135852254 GGTCTCCTCAGGATCCCCCTTGG + Intronic
999394781 5:151220617-151220639 TGTCACCTGAGGCCCAGCTTTGG + Intronic
1000312346 5:160057167-160057189 GCTATCCTGAGGCTTCTCTTAGG + Intronic
1001444791 5:171774914-171774936 GGTCTCCTGAGGGGCCTCCTGGG - Intergenic
1001697973 5:173686499-173686521 TTTCTCCTGAGGCTTCGCTTTGG - Intergenic
1002916084 6:1528958-1528980 AGCCTCCAGGGGCTCCGCTTTGG + Intergenic
1007585102 6:42984633-42984655 CGTCTCCTGCGGCCCCGCTCCGG - Exonic
1014917943 6:127176237-127176259 GGTTTGGTGAGGCTCCTCTTGGG - Intronic
1019053832 6:169205729-169205751 GGTCCCCTGAGGATCTGCTGTGG - Intergenic
1019221669 6:170478300-170478322 GGTCCACTGGGGCTCCCCTTGGG - Intergenic
1021348574 7:19559145-19559167 TGTCTCCTTCGGCTCCTCTTGGG + Intergenic
1024457325 7:49624199-49624221 GTTCTCCTGAGGCCTCTCTTTGG - Intergenic
1027539561 7:79452133-79452155 GCTCTCCTCTGGCTCCGATTTGG - Intronic
1029283473 7:99451145-99451167 GGTTTCCTGAGCCTCCACATGGG - Intronic
1034962142 7:155369461-155369483 GTTCTGCTGAGGCTTCTCTTGGG - Intergenic
1037191238 8:16128470-16128492 CTTCTCCTGAGGCTTCTCTTTGG - Intronic
1038506594 8:28090225-28090247 GGTCTCCTGAAGCTTCGGCTGGG - Intronic
1039838695 8:41278305-41278327 GGTCTGCTGACTCTCCACTTGGG - Intronic
1040482921 8:47842451-47842473 GCTCTCCTGAGGCTCTGTATAGG - Intronic
1041906552 8:63039035-63039057 CGTTTCCAGAGTCTCCGCTTAGG - Exonic
1044378589 8:91504798-91504820 GGTCCCCTGAGGCCCAACTTAGG - Intergenic
1045733806 8:105272107-105272129 GCTCTCCTGATGCCCAGCTTTGG - Intronic
1047761113 8:127955257-127955279 TGTCTCCTGAGGCCTCTCTTTGG - Intergenic
1049212299 8:141392299-141392321 GGCCTCCTGAGGCTCGGCCCCGG - Intronic
1050982999 9:12043693-12043715 GGTCTCCTGAGCCTCTGCTGTGG + Intergenic
1057826913 9:98378448-98378470 GGTCTCCTGGGGCCCAGCTGTGG - Intronic
1059037229 9:110767918-110767940 GGCCTCCTCAGGGTCCGCATAGG - Exonic
1059282081 9:113143678-113143700 GGTCTCCTGAGTCTCAGCCCAGG + Intergenic
1060277841 9:122195423-122195445 TGTCTCCTTAGGCTCCACTGGGG + Intronic
1061595112 9:131623930-131623952 GGTCACCTGAGGGTCCCCTCGGG + Intronic
1062125137 9:134856167-134856189 TGTCTCCAGAGGCTCCCCTGAGG - Intergenic
1062142593 9:134967832-134967854 GTTCTGCTGAGGCTGCGCTCTGG - Intergenic
1062493677 9:136821699-136821721 GAGCGCCTGCGGCTCCGCTTGGG + Intronic
1191257088 X:58284239-58284261 GGTCACCCGAGCCTCCTCTTTGG + Intergenic
1191257504 X:58285983-58286005 GGTCGCCTGGGCCTCCTCTTTGG + Intergenic
1195329246 X:103783451-103783473 GGGCTTCTGAGGCTCATCTTTGG + Intronic
1201343122 Y:12955073-12955095 GGTTACCTGAGGCTCCTCTGTGG - Intergenic