ID: 1172795922

View in Genome Browser
Species Human (GRCh38)
Location 20:37537518-37537540
Sequence CATTTCCTACACACTTTTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172795922_1172795930 29 Left 1172795922 20:37537518-37537540 CCCACAAAAGTGTGTAGGAAATG No data
Right 1172795930 20:37537570-37537592 GTGTACCCATTTTATTCCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172795922 Original CRISPR CATTTCCTACACACTTTTGT GGG (reversed) Intergenic
No off target data available for this crispr