ID: 1172798955

View in Genome Browser
Species Human (GRCh38)
Location 20:37563274-37563296
Sequence GCTGGGGTTCCTGGCAGGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172798948_1172798955 -6 Left 1172798948 20:37563257-37563279 CCCATCCACAGGCTACTGCTGGG No data
Right 1172798955 20:37563274-37563296 GCTGGGGTTCCTGGCAGGTGTGG No data
1172798950_1172798955 -7 Left 1172798950 20:37563258-37563280 CCATCCACAGGCTACTGCTGGGG No data
Right 1172798955 20:37563274-37563296 GCTGGGGTTCCTGGCAGGTGTGG No data
1172798944_1172798955 1 Left 1172798944 20:37563250-37563272 CCTCCTCCCCATCCACAGGCTAC No data
Right 1172798955 20:37563274-37563296 GCTGGGGTTCCTGGCAGGTGTGG No data
1172798945_1172798955 -2 Left 1172798945 20:37563253-37563275 CCTCCCCATCCACAGGCTACTGC No data
Right 1172798955 20:37563274-37563296 GCTGGGGTTCCTGGCAGGTGTGG No data
1172798942_1172798955 20 Left 1172798942 20:37563231-37563253 CCAGGAATTTGTTGTTCTGCCTC No data
Right 1172798955 20:37563274-37563296 GCTGGGGTTCCTGGCAGGTGTGG No data
1172798946_1172798955 -5 Left 1172798946 20:37563256-37563278 CCCCATCCACAGGCTACTGCTGG No data
Right 1172798955 20:37563274-37563296 GCTGGGGTTCCTGGCAGGTGTGG No data
1172798941_1172798955 21 Left 1172798941 20:37563230-37563252 CCCAGGAATTTGTTGTTCTGCCT No data
Right 1172798955 20:37563274-37563296 GCTGGGGTTCCTGGCAGGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172798955 Original CRISPR GCTGGGGTTCCTGGCAGGTG TGG Intergenic
No off target data available for this crispr