ID: 1172799250

View in Genome Browser
Species Human (GRCh38)
Location 20:37564684-37564706
Sequence GACGCCCAGAGCCCCCAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172799245_1172799250 1 Left 1172799245 20:37564660-37564682 CCAGAGACCACGCTCGGGCCGCC No data
Right 1172799250 20:37564684-37564706 GACGCCCAGAGCCCCCAGGAAGG No data
1172799246_1172799250 -6 Left 1172799246 20:37564667-37564689 CCACGCTCGGGCCGCCTGACGCC No data
Right 1172799250 20:37564684-37564706 GACGCCCAGAGCCCCCAGGAAGG No data
1172799244_1172799250 2 Left 1172799244 20:37564659-37564681 CCCAGAGACCACGCTCGGGCCGC No data
Right 1172799250 20:37564684-37564706 GACGCCCAGAGCCCCCAGGAAGG No data
1172799240_1172799250 22 Left 1172799240 20:37564639-37564661 CCGTGGAGAGCGGCTGCGGCCCC No data
Right 1172799250 20:37564684-37564706 GACGCCCAGAGCCCCCAGGAAGG No data
1172799238_1172799250 30 Left 1172799238 20:37564631-37564653 CCAGCGCTCCGTGGAGAGCGGCT No data
Right 1172799250 20:37564684-37564706 GACGCCCAGAGCCCCCAGGAAGG No data
1172799243_1172799250 3 Left 1172799243 20:37564658-37564680 CCCCAGAGACCACGCTCGGGCCG No data
Right 1172799250 20:37564684-37564706 GACGCCCAGAGCCCCCAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172799250 Original CRISPR GACGCCCAGAGCCCCCAGGA AGG Intergenic
No off target data available for this crispr