ID: 1172799437

View in Genome Browser
Species Human (GRCh38)
Location 20:37565680-37565702
Sequence GTGGAGAGTGGGCCTGGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172799427_1172799437 4 Left 1172799427 20:37565653-37565675 CCTTTTATAAGATCCTCACGCTG No data
Right 1172799437 20:37565680-37565702 GTGGAGAGTGGGCCTGGGCAGGG No data
1172799431_1172799437 -9 Left 1172799431 20:37565666-37565688 CCTCACGCTGCTGGGTGGAGAGT No data
Right 1172799437 20:37565680-37565702 GTGGAGAGTGGGCCTGGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172799437 Original CRISPR GTGGAGAGTGGGCCTGGGCA GGG Intergenic
No off target data available for this crispr