ID: 1172802627

View in Genome Browser
Species Human (GRCh38)
Location 20:37588235-37588257
Sequence TGTACCACTTTATACCTAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172802625_1172802627 30 Left 1172802625 20:37588182-37588204 CCACAGTAAGCAGAGACAATTAC No data
Right 1172802627 20:37588235-37588257 TGTACCACTTTATACCTAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172802627 Original CRISPR TGTACCACTTTATACCTAGT AGG Intergenic
No off target data available for this crispr