ID: 1172804404

View in Genome Browser
Species Human (GRCh38)
Location 20:37601043-37601065
Sequence TGTCCCATTGGAGAAATAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172804404_1172804409 16 Left 1172804404 20:37601043-37601065 CCTTCTATTTCTCCAATGGGACA No data
Right 1172804409 20:37601082-37601104 TATAACTTGGATAATTAGAAAGG No data
1172804404_1172804406 3 Left 1172804404 20:37601043-37601065 CCTTCTATTTCTCCAATGGGACA No data
Right 1172804406 20:37601069-37601091 ACCGATATACCTATATAACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172804404 Original CRISPR TGTCCCATTGGAGAAATAGA AGG (reversed) Intergenic
No off target data available for this crispr