ID: 1172804908

View in Genome Browser
Species Human (GRCh38)
Location 20:37604838-37604860
Sequence CCCGATCTAAATGATTTTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172804908_1172804918 4 Left 1172804908 20:37604838-37604860 CCTTTAAAATCATTTAGATCGGG No data
Right 1172804918 20:37604865-37604887 CCAACCTTGGGGCCAAGGACTGG No data
1172804908_1172804914 -1 Left 1172804908 20:37604838-37604860 CCTTTAAAATCATTTAGATCGGG No data
Right 1172804914 20:37604860-37604882 GGTCCCCAACCTTGGGGCCAAGG No data
1172804908_1172804913 -7 Left 1172804908 20:37604838-37604860 CCTTTAAAATCATTTAGATCGGG No data
Right 1172804913 20:37604854-37604876 GATCGGGGTCCCCAACCTTGGGG No data
1172804908_1172804920 9 Left 1172804908 20:37604838-37604860 CCTTTAAAATCATTTAGATCGGG No data
Right 1172804920 20:37604870-37604892 CTTGGGGCCAAGGACTGGTACGG No data
1172804908_1172804911 -9 Left 1172804908 20:37604838-37604860 CCTTTAAAATCATTTAGATCGGG No data
Right 1172804911 20:37604852-37604874 TAGATCGGGGTCCCCAACCTTGG No data
1172804908_1172804921 10 Left 1172804908 20:37604838-37604860 CCTTTAAAATCATTTAGATCGGG No data
Right 1172804921 20:37604871-37604893 TTGGGGCCAAGGACTGGTACGGG No data
1172804908_1172804923 17 Left 1172804908 20:37604838-37604860 CCTTTAAAATCATTTAGATCGGG No data
Right 1172804923 20:37604878-37604900 CAAGGACTGGTACGGGTCCGTGG No data
1172804908_1172804924 26 Left 1172804908 20:37604838-37604860 CCTTTAAAATCATTTAGATCGGG No data
Right 1172804924 20:37604887-37604909 GTACGGGTCCGTGGCCTGTTAGG 0: 4
1: 71
2: 543
3: 1115
4: 1280
1172804908_1172804912 -8 Left 1172804908 20:37604838-37604860 CCTTTAAAATCATTTAGATCGGG No data
Right 1172804912 20:37604853-37604875 AGATCGGGGTCCCCAACCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172804908 Original CRISPR CCCGATCTAAATGATTTTAA AGG (reversed) Intergenic
No off target data available for this crispr