ID: 1172810183

View in Genome Browser
Species Human (GRCh38)
Location 20:37641792-37641814
Sequence TCTGTGCCTCATTATGAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172810176_1172810183 29 Left 1172810176 20:37641740-37641762 CCCAGTTCTGCCACTTACTAGCT 0: 10
1: 108
2: 546
3: 1895
4: 4239
Right 1172810183 20:37641792-37641814 TCTGTGCCTCATTATGAGGGTGG No data
1172810178_1172810183 19 Left 1172810178 20:37641750-37641772 CCACTTACTAGCTGTGTTATCTA No data
Right 1172810183 20:37641792-37641814 TCTGTGCCTCATTATGAGGGTGG No data
1172810177_1172810183 28 Left 1172810177 20:37641741-37641763 CCAGTTCTGCCACTTACTAGCTG No data
Right 1172810183 20:37641792-37641814 TCTGTGCCTCATTATGAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172810183 Original CRISPR TCTGTGCCTCATTATGAGGG TGG Intergenic
No off target data available for this crispr