ID: 1172820037

View in Genome Browser
Species Human (GRCh38)
Location 20:37724500-37724522
Sequence CTGAGTGATTCAAAGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 210}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172820032_1172820037 0 Left 1172820032 20:37724477-37724499 CCTCAATTGAATGAGCTTCCTAA 0: 1
1: 0
2: 1
3: 24
4: 182
Right 1172820037 20:37724500-37724522 CTGAGTGATTCAAAGGTGGAGGG 0: 1
1: 0
2: 0
3: 10
4: 210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172820037 Original CRISPR CTGAGTGATTCAAAGGTGGA GGG Intronic
902028052 1:13399003-13399025 CTGACTATTTCAAAGGTGGCAGG - Intergenic
902874732 1:19333991-19334013 CTGAGTTAATCCACGGTGGAAGG - Intergenic
903974725 1:27141959-27141981 CTGAGGGATTCAATGGGTGAAGG + Intronic
904977922 1:34472703-34472725 CTGTGTGAATCAAGGGAGGATGG + Intergenic
905135627 1:35797176-35797198 CAGAGTGATTCAAAGAAGGAAGG - Intergenic
909080635 1:71107288-71107310 CTGAGTCATTCAAAAGAGCAAGG + Intergenic
915204696 1:154261336-154261358 CTGAGTGAAGCAAAGCTGTATGG - Intronic
916443249 1:164847897-164847919 CTGAGTGCTCCAGAGGTGGTGGG - Exonic
917296742 1:173527622-173527644 CCCAGTGACTCAAAGCTGGAGGG - Intronic
917417167 1:174822492-174822514 CTGAGTTTTTTAAATGTGGAAGG - Intronic
919599958 1:199610417-199610439 CTGAGTGAATAAAAGGAGGTAGG - Intergenic
922211926 1:223492984-223493006 CTAAGTGACTAAAGGGTGGATGG + Intergenic
923950843 1:238951606-238951628 CTGAGTCACTTAAAGGTGTAAGG - Intergenic
924159678 1:241218115-241218137 CTGACAGATTCTAAGGAGGAAGG + Intronic
924815737 1:247440349-247440371 CTGAGTGAGTAAACGGGGGACGG + Intronic
1063567448 10:7183264-7183286 CTGAGTGATGCAGAGGTGCTGGG - Intronic
1065231895 10:23606918-23606940 GTGAATGATTTAAAGGAGGATGG + Intergenic
1066033336 10:31452837-31452859 CTGAGTGATGCAAAGATCGGTGG - Intronic
1066327893 10:34383799-34383821 CTGTGTGCAGCAAAGGTGGACGG + Intronic
1067143982 10:43680209-43680231 CTGAGTCATCCCATGGTGGAAGG - Intergenic
1067159378 10:43810422-43810444 CTGAGTCAGTCACAGGTGGAAGG + Intergenic
1069656494 10:70093236-70093258 CTGAGTGCTTGAAATGTGGCTGG - Intronic
1069661247 10:70125058-70125080 CTGAGTCATCCCATGGTGGAAGG - Intronic
1072087300 10:92093249-92093271 CTTAGTCATTCATTGGTGGAGGG - Intronic
1074998573 10:118778665-118778687 CTGAGTGTGTCAAAGCTGGCTGG - Intergenic
1077053063 11:576314-576336 AAGAGTGTTTCCAAGGTGGAAGG + Intergenic
1078102937 11:8340453-8340475 CTGTGTGATGCAATGGAGGAGGG - Intergenic
1081071235 11:38611664-38611686 GGTAGTGATTCAAAGGTGGGAGG - Intergenic
1081806704 11:45894823-45894845 CTGGCTGCTCCAAAGGTGGATGG - Intronic
1084836804 11:71807799-71807821 CTGAGATATTCCAAGGAGGAGGG - Intergenic
1085479145 11:76807243-76807265 CTGAGTGACTCAAAGGATTAGGG + Intergenic
1085775929 11:79366437-79366459 CAGAGTGATTCACAGGTTTAAGG + Intronic
1089379636 11:118018532-118018554 GTTAGTGACTCACAGGTGGACGG + Intergenic
1090240135 11:125176026-125176048 TTGGGTGATTCAAAGCTGGCAGG + Intronic
1092402434 12:8188307-8188329 CTGAGATATTCCAAGGAGGAGGG + Intronic
1093038992 12:14358106-14358128 CTGCGTCATTCCATGGTGGAAGG + Intergenic
1095193039 12:39280206-39280228 CTTTGAGAGTCAAAGGTGGATGG + Intergenic
1096380398 12:51152600-51152622 CTGAATGATTTAAAGGTAAAAGG - Intronic
1096829230 12:54301349-54301371 CTGAGTCATATCAAGGTGGAAGG + Intronic
1097562093 12:61220251-61220273 ATGTGTGATTCGAAGGTGTATGG - Intergenic
1098854512 12:75637206-75637228 CAGAGTGATTCCAAGTGGGAAGG - Intergenic
1099374629 12:81884257-81884279 CTGAGGGAATCAAAGGAAGAGGG + Intergenic
1100598904 12:96095485-96095507 CTGAGTGATTCAAATCATGACGG + Intergenic
1101630416 12:106487719-106487741 CTGATCGCTTCAAAGGTGGTAGG + Intronic
1102368612 12:112361773-112361795 CTGTGGGATTTAAAGGAGGATGG - Intronic
1102832789 12:116021347-116021369 CTGAGTGATAAAATGTTGGATGG + Intronic
1103071708 12:117949740-117949762 TTGGTTGATTTAAAGGTGGAGGG + Intronic
1104121645 12:125805544-125805566 CTGAGCAACTCACAGGTGGAGGG + Intergenic
1105817294 13:24048169-24048191 CTGAGTGATACCCAGGTGGCAGG - Intronic
1110144856 13:72178223-72178245 CTCAGTGATTCCAAGGTGACTGG - Intergenic
1111384929 13:87512844-87512866 CTGATTGATTCAGAAGTGTAAGG + Intergenic
1111846973 13:93522904-93522926 CTGAAGGAGACAAAGGTGGAGGG + Intronic
1115882566 14:37936277-37936299 CTCAGTGATCCAAATGTTGAAGG - Intronic
1116233441 14:42247790-42247812 CTGAGTGGATCAAAGATGGCAGG - Intergenic
1117349390 14:54866642-54866664 CTGAGTGAGTCACAGGAAGATGG + Intronic
1118099758 14:62583842-62583864 CTAAGTGATTAACAGATGGAGGG + Intergenic
1118807760 14:69252574-69252596 ATAAGTGATTCAGAGGTGGAAGG + Intergenic
1119562945 14:75605407-75605429 GTGAGTCATTCATAGGTGGGAGG + Intronic
1125753626 15:42047353-42047375 CTGTGTCATTCCATGGTGGAGGG + Intronic
1126508033 15:49430635-49430657 CTGTGTCATTCCATGGTGGAAGG + Intronic
1126761907 15:51977244-51977266 CTTAGTGAGGCCAAGGTGGATGG - Intronic
1135527712 16:23226830-23226852 CTGGGGGCTTCAAAGGAGGAAGG - Intergenic
1136095215 16:27950715-27950737 CTAAGTGACTGAAGGGTGGAAGG - Intronic
1139171386 16:64634003-64634025 GTGTGTGATTCAATGGTGGCAGG + Intergenic
1140264016 16:73404822-73404844 CTAAGTGTTTCCCAGGTGGAAGG + Intergenic
1140809241 16:78561244-78561266 CAGAGAGATTCAAAGCAGGAGGG - Intronic
1140809249 16:78561334-78561356 CAGAGAGATTCAAAGCAGGAGGG - Intronic
1140853252 16:78954301-78954323 CTGAGTGGATAGAAGGTGGATGG + Intronic
1141641956 16:85346688-85346710 ATGAGTGATTGACAGGTAGATGG + Intergenic
1143287916 17:5805002-5805024 CTGTGTCATTCCATGGTGGAAGG + Intronic
1146313361 17:31788228-31788250 CTGAGTGATTAAATGATGGCTGG + Intergenic
1146986030 17:37219076-37219098 CTGTGTGATTAGAAGGTTGAGGG + Intronic
1153611001 18:6884756-6884778 ATGAGTGATCCAGAGATGGAAGG - Intronic
1153686383 18:7550248-7550270 CTGATTGATCCTAAGTTGGAAGG + Intergenic
1154637506 18:16876705-16876727 CTGATTGATCCAAGGGAGGAAGG + Intergenic
1156410925 18:36828219-36828241 CTGAGTCATTCAGTGGTGCAAGG + Intronic
1156411444 18:36831896-36831918 CTGATTCATTCAAATGTGGATGG + Intronic
1157575914 18:48742921-48742943 CTGAGTGATAGACTGGTGGAGGG - Intronic
1157947403 18:51996445-51996467 CATAGTGTTTCAAAGCTGGAAGG + Intergenic
1158942138 18:62414559-62414581 CTGAGTGCTTGAAATGTGGCTGG + Intergenic
1161778595 19:6277439-6277461 CTGAGTGCTTAAAATGTGGCTGG + Intronic
1162948040 19:14055227-14055249 CTGGGGGAGTCAGAGGTGGAGGG + Intronic
1164670019 19:30067141-30067163 CTGTGTGAAGCAAAGGGGGATGG + Intergenic
1167730659 19:51251855-51251877 GTGAGTGATGCAAAGGTGTTCGG - Intronic
1168447230 19:56430466-56430488 CTGATTGATTGGATGGTGGAAGG + Intronic
927023378 2:19040875-19040897 CTGATTTCTTCAAAGGTGGCAGG + Intergenic
928158291 2:28895741-28895763 CTGAGTGACTCAACAGTGAAAGG - Intronic
929222961 2:39484365-39484387 CTGTGTTATTCCATGGTGGAAGG - Intergenic
931410126 2:62021479-62021501 CTGAGAGAGACAAAGTTGGAGGG + Intronic
931666114 2:64610583-64610605 CAGGGTGATTCAAAGGTTGTTGG - Intergenic
933311157 2:80662884-80662906 CTGTGTGATACAAAGAAGGAGGG + Intergenic
934706442 2:96484859-96484881 TTGAGTTATCCCAAGGTGGAAGG - Intergenic
938187646 2:129246114-129246136 ATGAGTACTTCAAAGGAGGAAGG + Intergenic
939394612 2:141612735-141612757 CTGAGTGATGCGAAGGCGAAAGG - Intronic
942174390 2:173317879-173317901 CAAAGTCATTCCAAGGTGGAAGG + Intergenic
943217883 2:185062338-185062360 TTGAGTGATTCCAAATTGGATGG + Intergenic
943723314 2:191227967-191227989 CTGAGTGCTTCAGATGTTGAAGG - Intergenic
944300127 2:198114393-198114415 CTGAATAATTCAAAAGTGGCAGG + Intronic
946451027 2:219779571-219779593 CTGAATGATACAAGGGGGGAAGG - Intergenic
946796417 2:223359045-223359067 CTGAGTGCTTGAAATGTGGCTGG + Intergenic
947529467 2:230899561-230899583 CTGAGTGATCCAAAGGACCAAGG - Intergenic
948497315 2:238360043-238360065 CTAAGTGACTAACAGGTGGATGG + Intronic
1168794667 20:603493-603515 CTCTGGGCTTCAAAGGTGGACGG + Intergenic
1170586121 20:17735420-17735442 CTGACTCATTCCAGGGTGGACGG + Intronic
1170606520 20:17878768-17878790 CTGAGTGATACAGAGTGGGAGGG + Intergenic
1170838751 20:19907052-19907074 CTGCGTCATTCCATGGTGGAAGG + Intronic
1172231689 20:33340963-33340985 CAGGGTGATTGGAAGGTGGAGGG - Intergenic
1172820037 20:37724500-37724522 CTGAGTGATTCAAAGGTGGAGGG + Intronic
1173034215 20:39393357-39393379 TTGAGTGATTGAAATGTGGCTGG + Intergenic
1173094629 20:40013324-40013346 CTGGGTGATTTAGAGGTTGAAGG - Intergenic
1173526166 20:43734567-43734589 CTGAGTGAAGCAAAGGTTCATGG - Intergenic
1175126497 20:56756102-56756124 CTGTGTCATTCCATGGTGGAAGG + Intergenic
1175697420 20:61113085-61113107 CTGAGTGACCCAAAAGTGGGAGG + Intergenic
1176001798 20:62835312-62835334 CTGCGTCATTCCATGGTGGAAGG + Intronic
1177758162 21:25372466-25372488 CTGTGTGAATTAGAGGTGGATGG + Intergenic
1180186142 21:46140312-46140334 CTGAGCAATGCGAAGGTGGACGG - Intronic
1180186183 21:46140513-46140535 CTGAGCAATGCGAAGGTGGACGG - Intronic
1183482126 22:38070877-38070899 CTGAGCTATACAAAGGTGGGTGG + Exonic
1185227619 22:49661768-49661790 CAGAGTGTCTCACAGGTGGACGG + Intergenic
949813256 3:8030903-8030925 CTGAGTGAGTCAAGGGTATAAGG - Intergenic
953889317 3:46739546-46739568 TTTAGTGATGCAAAGGAGGAGGG - Intronic
954674055 3:52306032-52306054 CTGAGTGATCCAAAGGTCAGGGG + Intergenic
954727953 3:52631889-52631911 GAGACTGATTCAAAGATGGAAGG + Intronic
956334801 3:68151549-68151571 CTGAGTCATACCATGGTGGAAGG + Intronic
956475049 3:69610619-69610641 TTTAGAGATTCATAGGTGGAAGG + Intergenic
957148445 3:76454467-76454489 CTGTGAGATTAAAAGGTGGTTGG + Intronic
959454451 3:106541433-106541455 CTGAGTGGATCAAAGGTGAGGGG + Intergenic
961076818 3:123990489-123990511 CTCTGTGATTCAAAAGTGCATGG - Intronic
963062993 3:141240419-141240441 CTGAGTGAGGCAAAGGAGCATGG - Intronic
963414178 3:144973377-144973399 CTTAGTGATTCTAAGCTGCACGG - Intergenic
964390051 3:156187204-156187226 CTGAGAAATACCAAGGTGGAGGG - Intronic
964417966 3:156469559-156469581 CTGACTTATTTAAAGGTGGAGGG - Intronic
966284956 3:178284709-178284731 CTGAGTGGTTTAGAGGTGGTGGG + Intergenic
966337167 3:178881294-178881316 CTAAGTGATTCTAAGGTAGAAGG + Intergenic
967774742 3:193374936-193374958 CTGTGTCATTCCATGGTGGAAGG - Intronic
969158714 4:5236244-5236266 CTGAGTGAGTGCCAGGTGGAAGG - Intronic
969778203 4:9375293-9375315 CTGAGATATTCCAAGGAGGAGGG - Intergenic
972645278 4:40962145-40962167 CTGAGTTTTTCAAAGATGCAGGG + Intronic
973932272 4:55805111-55805133 CTGAGTGATTCCTATGTGGTAGG - Intergenic
978580875 4:110229912-110229934 CTGAGTGACTTACAGGTGGGAGG - Intergenic
979767472 4:124479684-124479706 CTGAGTGATTAAAACATGGTAGG - Intergenic
980205176 4:129709695-129709717 CTGAGTCATTTAAGGGTTGATGG - Intergenic
982293578 4:153804323-153804345 CTGTGTCATCCCAAGGTGGAGGG + Intergenic
982303408 4:153903439-153903461 CTGAGACATTTAAAGTTGGAGGG + Intergenic
983574576 4:169247331-169247353 CTGAGAGAGTGAATGGTGGACGG + Intronic
985048632 4:185967143-185967165 TTCAGTGATTCCAAGCTGGAAGG + Intergenic
989597475 5:43170402-43170424 CTGAATGATTCCAGGATGGAAGG - Intronic
990062084 5:51663485-51663507 CTGAGTGAAACAAATGTGTAGGG + Intergenic
991026029 5:62030752-62030774 CTGAGTAAATCAAATGTGTATGG - Intergenic
991491516 5:67188236-67188258 CTGTGTGATTCCATGGAGGAAGG - Intronic
992118282 5:73564186-73564208 TTCAGTGATTCAAAGGGAGATGG + Intronic
995506980 5:112870793-112870815 CTGTGTGATCCCATGGTGGAAGG - Intronic
999624343 5:153504649-153504671 CTGAGTTAATCAAAGCTGTAGGG + Intronic
1001149097 5:169211253-169211275 CTGAGTAATGCAGAGGAGGAGGG + Intronic
1001676911 5:173526254-173526276 ATGAGTGATTCAAAAGTGCAAGG - Intergenic
1002579171 5:180197235-180197257 TTGAGTGATTCACAGGTGTGTGG - Intronic
1002765423 6:234911-234933 CTGAGGGAAGCAAAGGTGCATGG + Intergenic
1003321450 6:5055671-5055693 CTGAGTGGTTTAGGGGTGGAGGG - Intergenic
1004933846 6:20488561-20488583 CAGTGTGATTCAAAGGTGTGTGG - Intronic
1004946782 6:20623621-20623643 CAAAGTGAATCAAAGTTGGAGGG + Intronic
1007083707 6:39127727-39127749 GTGAGGGATTCCATGGTGGAGGG + Intergenic
1007769258 6:44180090-44180112 CTGTGTGGCTCAAAGGTGGAGGG - Exonic
1008536694 6:52511662-52511684 TTTAGTGACTCAAAGGTGGGTGG - Intronic
1011954445 6:93008667-93008689 CTGAGAGCTTCATATGTGGAAGG - Intergenic
1012878031 6:104752899-104752921 TTAAGTAATTCAAATGTGGATGG + Intronic
1013412874 6:109897426-109897448 CTGAGTGAGGCTAAGCTGGAGGG - Intergenic
1013769155 6:113607999-113608021 ATTAGTGATTGAAGGGTGGAAGG + Intergenic
1016311271 6:142736185-142736207 CTTTGTGATGCCAAGGTGGATGG - Intergenic
1017245961 6:152224845-152224867 CTGAGTGTTTAAAGTGTGGAAGG - Intronic
1017643378 6:156515871-156515893 GTGAGTGAGGCAAAGGTGGGTGG - Intergenic
1017657968 6:156648240-156648262 TTGACTGATTCATGGGTGGAGGG - Intergenic
1020692233 7:11369916-11369938 CTGAGTGGTTCACAGATTGAGGG + Intergenic
1022422423 7:30236522-30236544 GTGAGGGATTCAAAAGTGAATGG - Intergenic
1022581360 7:31558158-31558180 CTGTGTCATTCCATGGTGGAAGG - Intronic
1028654634 7:93190394-93190416 ATGAGGGATTCAAAGGATGAAGG + Intronic
1028771932 7:94635861-94635883 TTGAGTGAATTAAAGGTGAAGGG - Intronic
1030008693 7:105143905-105143927 CTGATTGATTGAAAGGTTGGAGG - Intronic
1032614759 7:133455995-133456017 CTGGCTTATTCCAAGGTGGAAGG - Intronic
1033513251 7:142081730-142081752 CTGAGGGGTGCAAGGGTGGAAGG + Intronic
1033616502 7:143021561-143021583 CTGTGTCATTCCATGGTGGAAGG - Intergenic
1034069318 7:148167632-148167654 CAGAGTAATTCAGAGCTGGAAGG + Intronic
1036275659 8:7349289-7349311 CTGAGATATTCCAAGGAGGAGGG - Intergenic
1036345694 8:7961068-7961090 CTGAGATATTCCAAGGAGGAGGG + Intergenic
1036841020 8:12121822-12121844 CTGAGATATTCCAAGGAGGAGGG + Intergenic
1036862828 8:12368074-12368096 CTGAGATATTCCAAGGAGGAGGG + Intergenic
1038024442 8:23576203-23576225 CTGACTGATTCCATGGTGGAGGG - Intergenic
1038153641 8:24965992-24966014 CAGAGCTATCCAAAGGTGGAAGG + Intergenic
1040939638 8:52819060-52819082 CTGGGTGATTCATATGTAGATGG + Intergenic
1044913932 8:97091829-97091851 GTGAGAGATACAAAGATGGATGG + Intronic
1046126306 8:109913147-109913169 CTTTGTGATGCCAAGGTGGAAGG - Intergenic
1046488529 8:114917116-114917138 CTGATTGATTGAAAAGAGGAAGG - Intergenic
1047445609 8:124916399-124916421 CTGAGTAATTAAAGGGTAGAAGG - Intergenic
1047634538 8:126745819-126745841 GTCAGTGATTTAAAAGTGGAAGG + Intergenic
1048166872 8:132069744-132069766 CTGAGGGTTTCATAGTTGGAAGG - Exonic
1052352661 9:27473314-27473336 CTGAGGGAGGCAAAGGGGGAGGG + Intronic
1053450600 9:38191334-38191356 CTTAGTGAGTCCAAGATGGAGGG + Intergenic
1053782804 9:41628895-41628917 CTGATTGATCCAAGGGAGGAAGG - Intergenic
1054170755 9:61839035-61839057 CTGATTGATCCAAGGGAGGAAGG - Intergenic
1054666781 9:67741772-67741794 CTGATTGATCCAAGGGAGGAAGG + Intergenic
1056110231 9:83388027-83388049 CTGAGTGAGACGAAGGTGGCAGG - Intronic
1056549293 9:87638436-87638458 TTGAGTGATGCAAAGGCGTATGG + Intronic
1061890007 9:133614137-133614159 GTGAGAGTTTCAAAGGTTGATGG + Intergenic
1062235566 9:135506142-135506164 CTGGGTGAAACAAAGGTTGAGGG + Intergenic
1203734798 Un_GL000216v2:126462-126484 CTTAGTGAGGCAAAGGTGGGAGG + Intergenic
1185542620 X:915634-915656 CTGAGTGCTCCAAGGATGGAGGG - Intergenic
1186116512 X:6309831-6309853 CTGACTAATACAAATGTGGAAGG + Intergenic
1186715391 X:12245821-12245843 CTGAGTCACTCCATGGTGGAAGG - Intronic
1187823224 X:23310165-23310187 CTCAGTGATTTAGAGGTGGTAGG + Intergenic
1188019268 X:25139074-25139096 CTGAGTGATTCAGAGATGTGTGG + Intergenic
1188436183 X:30161193-30161215 GTTAGTGCTTAAAAGGTGGAAGG + Intergenic
1188760391 X:34021157-34021179 CTGTGTCATTCCATGGTGGAAGG + Intergenic
1192336984 X:70229807-70229829 CTGAGTCATTCCATGGTAGAAGG + Intergenic
1192824912 X:74684869-74684891 CTGACTGATACAAATGTGGAGGG + Intergenic
1193086308 X:77450078-77450100 CTGATTAACTCAAATGTGGAGGG - Intronic
1193255246 X:79341098-79341120 CTGCATGATTCAAATGTGGCAGG - Intergenic
1193925783 X:87482308-87482330 GTGAGAGAATCAAAGGAGGAAGG - Intergenic
1194109304 X:89812602-89812624 CTGTGTCATTCCATGGTGGAAGG + Intergenic
1197551999 X:127902533-127902555 CTCACAGATTCAAAGGTAGAAGG + Intergenic
1198173305 X:134129339-134129361 CTCAGTGGTGCAATGGTGGAAGG + Intergenic
1200461967 Y:3467344-3467366 CTGTGTCATTCCATGGTGGAAGG + Intergenic
1201239488 Y:11944970-11944992 ATAAGTGAATCAAAGTTGGAGGG - Intergenic