ID: 1172822017

View in Genome Browser
Species Human (GRCh38)
Location 20:37744932-37744954
Sequence CTGTTTCAGTGTATGATATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 198}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172822017_1172822018 7 Left 1172822017 20:37744932-37744954 CCTTATATCATACACTGAAACAG 0: 1
1: 0
2: 0
3: 14
4: 198
Right 1172822018 20:37744962-37744984 GAGTCTGTGAGTTGAGAAAAAGG 0: 1
1: 0
2: 1
3: 19
4: 345

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172822017 Original CRISPR CTGTTTCAGTGTATGATATA AGG (reversed) Intronic
900877324 1:5352397-5352419 CTGTGTCAGTGTCTGCCATAGGG + Intergenic
902290745 1:15433066-15433088 ATGTTTCTGTGTATGACATATGG + Intergenic
902933047 1:19744924-19744946 CTGGTTCAGTATATGACACATGG + Intronic
908927266 1:69270746-69270768 CTGTTTCTGTGTCTGTTATCAGG - Intergenic
909952736 1:81738676-81738698 CAGTTTCACTGTATGGAATAGGG - Intronic
909966440 1:81917195-81917217 CAATTTCAGTATAGGATATATGG - Intronic
912126788 1:106549349-106549371 GTGTTTCATTGTATGATGTTAGG - Intergenic
915997636 1:160580373-160580395 CTAATTCACTGTGTGATATAGGG - Intergenic
918984314 1:191603438-191603460 CTTCTTCAATATATGATATATGG + Intergenic
922020404 1:221698686-221698708 CTTTGTCAGTGTTTGATACAAGG - Intergenic
923210609 1:231800908-231800930 CTCTCTCGGTGTATTATATATGG + Intronic
924399166 1:243659705-243659727 TTATTTCAGTACATGATATAAGG - Intronic
1064225954 10:13485381-13485403 CAGATTCTGTGTATTATATAGGG + Intronic
1065514168 10:26507892-26507914 CTTTCTCACTGTCTGATATATGG - Intronic
1066356499 10:34689510-34689532 CTACTTCAGTCTATGGTATAAGG + Intronic
1066777500 10:38899255-38899277 CTGTTTGAGTCTATGACATGTGG - Intergenic
1068372155 10:56130899-56130921 CAGTTTCAGTTTTTGACATATGG - Intergenic
1068829937 10:61482285-61482307 TTATTTCAGTATATAATATAAGG - Intergenic
1072825836 10:98605407-98605429 TTGTTTTAGTGTATGTCATAAGG + Intronic
1073003191 10:100300642-100300664 CTTTCTCAGTGCATGATATCAGG + Intronic
1073739401 10:106389556-106389578 ATGTTTCAGTGTATGATTTGGGG - Intergenic
1074369046 10:112884258-112884280 CTTTTTCAGTGCATCATATCAGG + Intergenic
1078742797 11:14083033-14083055 CTGTTTTAGTTTTTGATACATGG - Intronic
1079504764 11:21141425-21141447 CTGTTTCACTGTGTGATCTTGGG + Intronic
1079676437 11:23232642-23232664 TTGTTTGATTGTAGGATATAAGG - Intergenic
1081046840 11:38284655-38284677 TGTTTTCAGTGTATGCTATAGGG - Intergenic
1081245504 11:40761718-40761740 CCTTTTCAATGTATGATAAAAGG + Intronic
1086154749 11:83653391-83653413 CTGTTTAAGAGAATTATATATGG - Intronic
1087634674 11:100688507-100688529 CTGTTATAGTCTATAATATAGGG + Intronic
1087749774 11:101994535-101994557 ATGTTTTTGTGTATGGTATAAGG + Intronic
1088265619 11:107985001-107985023 CTGATTCAGTGTCCAATATATGG + Intergenic
1093574846 12:20715044-20715066 CTAGTTCAGTTTAAGATATACGG + Intronic
1094327035 12:29251814-29251836 CTGAATCAGTGTCTAATATATGG + Intronic
1097334828 12:58370385-58370407 CTTCTACAGTGTGTGATATAAGG - Intergenic
1099597483 12:84685830-84685852 ATGTTTCAGTCAATGATAGACGG - Intergenic
1102841472 12:116129242-116129264 CTGTCTCAGAGTATAATATTTGG - Intronic
1104065779 12:125304577-125304599 CAGTTTTGGTGTATGGTATAAGG + Intronic
1104874390 12:132023664-132023686 GTGCTTCAGTTTATGATAGATGG + Intronic
1105950170 13:25223174-25223196 ATGATCCAGTGTATGCTATATGG + Intergenic
1109791933 13:67260047-67260069 CAGTTTCAGACTATGATGTAAGG + Intergenic
1110657640 13:78019197-78019219 CTGTTTCCTTGAATGAAATATGG + Intergenic
1114994708 14:28333708-28333730 CTCTTTCTGTGTATAATTTAAGG + Intergenic
1114996061 14:28353686-28353708 CTGCTTCAGTGTATGCTGTATGG - Intergenic
1115816982 14:37174230-37174252 CTGTTTCAGTGTGTGCACTAGGG - Intergenic
1117005888 14:51420644-51420666 CTGTTTCACTGTATTGTTTAGGG - Intergenic
1117302800 14:54445128-54445150 CAGTTTCATTCTATGAGATAAGG - Intergenic
1117896716 14:60495121-60495143 CTGTTCCAATGTAAGATCTATGG - Intronic
1118168906 14:63365746-63365768 CTCTTTCAGTGCATGATATCAGG - Intergenic
1118197252 14:63638894-63638916 CTGTTTCATTATATGACAAAAGG + Intronic
1120367455 14:83589256-83589278 TTGATTTAGGGTATGATATATGG + Intergenic
1120814886 14:88845801-88845823 CTGTTTCACTGTGTGATCTCAGG - Intronic
1121749078 14:96331600-96331622 CTGTTTCAGTGGATGAATCAAGG - Exonic
1124255168 15:28135190-28135212 GTGATTCAGTGGATGATTTAAGG + Intronic
1124569140 15:30844417-30844439 GTGATTCAGTGGATGATTTAAGG - Intergenic
1125990907 15:44106916-44106938 TTGTTTATGTGGATGATATATGG + Intronic
1126273836 15:46852280-46852302 CATTTTCAGTATATGACATATGG + Intergenic
1126457473 15:48879255-48879277 CATTTTCAGTGTAAGATAAATGG + Exonic
1126610493 15:50524098-50524120 CGGTTTTTGTTTATGATATAAGG - Intronic
1126645502 15:50871165-50871187 CTGTTTTAGTTTTTTATATAGGG + Intergenic
1129577598 15:76767621-76767643 TTATTTCAGTGTTTGATTTAGGG - Intronic
1130363380 15:83210262-83210284 CTGTTTCACTGAATGGTATTGGG + Intergenic
1130513782 15:84610155-84610177 CTGTTCCAGTGAATGATTTTTGG + Intronic
1130707529 15:86247447-86247469 CTTTCTCAGTGTATCATATCGGG + Intronic
1131880951 15:96861368-96861390 CTGGGTCAGTGTATGATACGTGG + Intergenic
1138845944 16:60566332-60566354 CTTTTTATGTGTGTGATATATGG - Intergenic
1139095129 16:63696236-63696258 CTGTTTCACAGTATGATATTTGG + Intergenic
1139362362 16:66408169-66408191 CAGTTACAGTCTATGATATGAGG + Intergenic
1140580289 16:76223508-76223530 CTATTTCAGTGTTTGTCATAAGG - Intergenic
1142543031 17:676234-676256 CTGTTTCCGTGGATGAAAGAGGG + Intronic
1150051657 17:61970307-61970329 CTGATTCAGTGGATGAAAAATGG - Intronic
1153451075 18:5229666-5229688 CTGTTTCATAGAATGATTTAGGG + Intergenic
1154997128 18:21651171-21651193 CTATTTCAATGTAAGTTATAAGG - Exonic
1156110305 18:33718274-33718296 ATGTTTGAGTGTATGGGATATGG - Intronic
1158992953 18:62888982-62889004 CTGTTTCAGAGAAAGATAGAGGG - Intronic
1162103647 19:8356210-8356232 CCTTCTCAGTGTATGATATCAGG - Intronic
1164102424 19:22068994-22069016 CTGTCTCAGTGTAAGAGAAATGG + Intronic
1167159919 19:47760578-47760600 CTGTTTCCGTGTGTGAAATGGGG + Intergenic
929584519 2:43105394-43105416 CTGTCTCAGGGCATAATATAAGG - Intergenic
931381300 2:61756023-61756045 AAGATTCAGTGTATGATAAAGGG + Intergenic
932316149 2:70784665-70784687 ATGTTGCATGGTATGATATAAGG - Intronic
936899031 2:117462942-117462964 CTGTTTCATAGAATGATTTATGG + Intergenic
939206005 2:139104505-139104527 TTATTTTTGTGTATGATATAAGG + Intergenic
940817597 2:158313074-158313096 TTGTTTACGTGTATGTTATAAGG + Intronic
941914914 2:170805438-170805460 CTTTTTTAGTATATAATATAGGG - Intergenic
943182464 2:184561040-184561062 CTGATTCAGTGTCCAATATATGG + Intergenic
943263724 2:185698625-185698647 CTGAATCAGTGTACAATATATGG + Intergenic
943643915 2:190387692-190387714 CTGCTGCCGTGGATGATATATGG + Intergenic
948503602 2:238412203-238412225 GTGCTTCTGTGTATGTTATACGG - Intergenic
1168935939 20:1665291-1665313 CTGCTTCAGTGGATGTTAGATGG + Intergenic
1169766682 20:9154640-9154662 CTGGTACAGTGCATGGTATATGG - Intronic
1170144504 20:13158043-13158065 TTGTTTAAGTGTATGTTTTATGG - Intronic
1170200162 20:13733986-13734008 CTATGTCACTGTATGATATTGGG - Intronic
1172822017 20:37744932-37744954 CTGTTTCAGTGTATGATATAAGG - Intronic
1173110285 20:40180895-40180917 CTATTTCAGTATCTGATACAGGG + Intergenic
1173368382 20:42410661-42410683 TTGTTTCATAGTATGGTATATGG - Intronic
1175410001 20:58761269-58761291 CTGTTTCTTTCTTTGATATAGGG - Intergenic
1176890868 21:14317372-14317394 CTATTTCAGAGTATGATTTTTGG - Intergenic
1185136957 22:49078767-49078789 TTGTTTCTGTGTATGATGCATGG + Intergenic
950003918 3:9679170-9679192 CTGTTTGAGTGTATGAAGTAGGG + Intronic
950844642 3:16002763-16002785 CTCTTTCAGTTTCTGATAAAGGG + Intergenic
951724440 3:25741409-25741431 CTGTTTCAATAAATGATATTAGG + Intronic
951912836 3:27769307-27769329 CTGCTTCAGTGTTTGATATTGGG + Intergenic
951978952 3:28544789-28544811 CTGAATCAGTGTCTGATATGTGG + Intergenic
952613240 3:35236844-35236866 ATTTTTCAGTGTATGATTTGGGG + Intergenic
956656294 3:71555849-71555871 GTATTTCAGTGTATGGTATGAGG - Intronic
957299576 3:78374499-78374521 CTATTTCTGTGTAAGAAATAAGG - Intergenic
959226594 3:103595883-103595905 CTGAATCAGTGTCTGATATATGG - Intergenic
959674341 3:109017897-109017919 CTGATTCAGTGTGTGATTTGCGG - Intronic
960169811 3:114446714-114446736 CTGTTTCAGTGTTTGGCCTACGG + Intronic
960250166 3:115442983-115443005 CTGTTTTTGTTTGTGATATAGGG + Intergenic
963892999 3:150656833-150656855 CTGTTTCAGGGTAAGATTTTGGG + Intergenic
964254707 3:154762846-154762868 CTGTTTCAAGGGTTGATATAAGG + Intergenic
964460280 3:156917521-156917543 CTATTTCTTTGTGTGATATATGG - Intronic
964913277 3:161808456-161808478 CTGGATCAGTGGATTATATATGG + Intergenic
965055300 3:163705389-163705411 ATGTTTATGTGTATGATATGTGG - Intergenic
967227079 3:187302308-187302330 TTTTTTCACTGTATGAAATAGGG - Intergenic
970565605 4:17329472-17329494 CTTTTTCAGTGTCAGATATTTGG - Intergenic
970698048 4:18700767-18700789 CTTTCTCAGTTTAGGATATATGG + Intergenic
972046131 4:34666661-34666683 CTTTTTCAGTGCATGAAAAATGG + Intergenic
975072896 4:70164385-70164407 CTGATCCAATGTAGGATATAGGG - Exonic
975627208 4:76361655-76361677 GTGTTTCACTGTTTAATATAAGG + Intronic
975888163 4:78991115-78991137 CTGTTTATCTGTATGAGATAGGG + Intergenic
975937252 4:79597056-79597078 CTCTGTAAGTGTATAATATAAGG - Intergenic
976018734 4:80593307-80593329 CTGCTTCAGTTTTTGAGATATGG + Intronic
976368151 4:84254224-84254246 TTGTTTCAGGGTATGATTTTAGG - Intergenic
978292224 4:107155018-107155040 CAGTTTCTTTATATGATATATGG - Intronic
978407714 4:108397438-108397460 ATGTTTGAGTGTGTGCTATATGG - Intergenic
980195557 4:129583530-129583552 CTGTTTCAGGGTATCAAAAATGG - Intergenic
980826424 4:138079019-138079041 CTGCTTCAAAGTATGATATCAGG + Intergenic
984239192 4:177196935-177196957 CTCTTTCTGTGTATCATATTTGG + Intergenic
985253350 4:188044708-188044730 CTGATTCACTGAATGATATATGG - Intergenic
986071990 5:4294501-4294523 CTCTTTCAGTGTATGTTCAAAGG + Intergenic
986356229 5:6929817-6929839 CTGTTTCAATCTTTGGTATATGG + Intergenic
990364060 5:55051502-55051524 CTGTTTTAGAGAAAGATATATGG + Intergenic
992509793 5:77421655-77421677 ATGTGTCAGTATATTATATATGG + Intronic
992767714 5:80016525-80016547 CTGTTTCACTGTATGAAAGCAGG + Intronic
994361609 5:98856318-98856340 CTGTGTTGGTTTATGATATATGG + Exonic
995621575 5:114031511-114031533 ATGTTTCACTGTATGAGCTAGGG + Intergenic
997714367 5:136030816-136030838 CTGTTGCAGGGCATGCTATAAGG - Intronic
997802140 5:136874187-136874209 AAGTTTGAGTGTATGATACATGG + Intergenic
1000264822 5:159625395-159625417 CTGGTTTATTGAATGATATAGGG - Intergenic
1000317158 5:160103788-160103810 CAGTTTAAGAGTATGATAGACGG + Intronic
1004679498 6:17879296-17879318 CTGTTTCAGTATTTCATACAGGG + Intronic
1009271574 6:61621444-61621466 CTCTTTCACTGAATGAGATAAGG - Intergenic
1009378714 6:63003876-63003898 CTGTTTCATTCTGTGAGATATGG + Intergenic
1009389930 6:63133678-63133700 CTGTATCAGTGTCCAATATATGG - Intergenic
1010970982 6:82263362-82263384 CTGTATCTGTGTGTGTTATATGG - Intergenic
1011314854 6:86020114-86020136 CTACTTCAGTGTATGCTATGTGG + Intergenic
1011929748 6:92696465-92696487 TTGTTACAGTGCATGATGTAAGG - Intergenic
1012895774 6:104946292-104946314 CTGTTCCTGTGTATGATTGAGGG + Intergenic
1012993014 6:105945701-105945723 CTGTTGCAGTGGGAGATATAAGG + Intergenic
1013802241 6:113960919-113960941 TTGTTACACTGTATGATTTAGGG - Intronic
1015228977 6:130891881-130891903 CTGTTTCAGTTTATCATGAAAGG - Intronic
1015934003 6:138390251-138390273 GTGTTTTAGTTTATGATTTAAGG + Intergenic
1016673497 6:146735848-146735870 CTGTTTCATTGACTGCTATAAGG - Intronic
1016736687 6:147487336-147487358 CTGTTTCATTGTACTCTATATGG + Intergenic
1016911539 6:149203909-149203931 TTCTTTCAGTGTAAAATATAGGG + Intergenic
1018713921 6:166517126-166517148 TTATTTTAGTGTAAGATATAGGG - Intronic
1019842444 7:3461699-3461721 CTGTTTCTCTGTAACATATAAGG - Intronic
1020592693 7:10161758-10161780 CTTGTTCCATGTATGATATAGGG + Intergenic
1021406150 7:20269315-20269337 CTGGTTCAGAGTATCTTATAAGG - Intergenic
1021630563 7:22641503-22641525 TTGTTTCTTTGTATGATAAAAGG + Intergenic
1023310492 7:38881514-38881536 CTGTTACAGAGAATAATATAAGG + Intronic
1023383364 7:39630674-39630696 TTATTTCTATGTATGATATAAGG + Intronic
1026427629 7:70312213-70312235 CTTTTTCTGTGTGTGATTTATGG + Intronic
1028090904 7:86699668-86699690 CTATTTCAGTATGTGATAGAAGG - Intronic
1028360772 7:89964034-89964056 CTGTTTAAGTCTATTATTTAAGG - Intergenic
1028682857 7:93557725-93557747 TTGTTTCTGAGTATGATAGAAGG + Intronic
1030414540 7:109225771-109225793 CTGTTCCATTGTATTATGTAAGG + Intergenic
1031230490 7:119099805-119099827 CTGATTCAGTGTGTGAGACAAGG + Intergenic
1031676731 7:124619681-124619703 CTGAATCAGCGTCTGATATATGG + Intergenic
1033180130 7:139168985-139169007 CTGTTCCAAGGTCTGATATATGG + Intronic
1034192262 7:149221772-149221794 CTATTTAAGAGTATCATATAAGG + Intronic
1034286758 7:149889230-149889252 TTGTTTCTGTGCATGATCTAAGG - Intergenic
1034298742 7:149996524-149996546 TTTTTTCAGTGTATGTTCTAAGG + Intergenic
1034807275 7:154100257-154100279 TTTTTTCAGTGTATGTTCTAAGG - Intronic
1037057447 8:14459725-14459747 CCTTTTCAGTGTATCATATTAGG - Intronic
1038027412 8:23604116-23604138 TTGTTTCAGTATATGGTATAAGG - Intergenic
1042749467 8:72142201-72142223 CTGTTTCACTGTATGCAACATGG - Intergenic
1043018551 8:74970978-74971000 TTGTTTCATTGTATGTTAAAAGG + Intergenic
1044651769 8:94503368-94503390 CTTTTTCAGTGCATCATATAAGG - Intronic
1044743520 8:95351105-95351127 CTGTTTCAGTGCAGGGTACATGG + Intergenic
1045163134 8:99572072-99572094 CTTTATCATTTTATGATATAAGG + Intronic
1045735733 8:105294703-105294725 CTGTTCCAGTGTATCATTTTTGG - Intronic
1045737462 8:105313574-105313596 CTGTCTCAGAGTGTGATGTAGGG - Intronic
1049027025 8:139998950-139998972 CTGTTTCAGTGTTTTCTCTAGGG - Intronic
1050530141 9:6581438-6581460 CTGTTTCAGGGTCTGATTTTGGG + Intronic
1051051437 9:12936982-12937004 CTCTTTCTGTGTATTATATTTGG + Intergenic
1051453006 9:17218883-17218905 CTGTTGTAGTGTATAATATATGG + Intronic
1053226529 9:36363029-36363051 TTGTTTCAGTCTATGAGACAGGG + Intronic
1053836356 9:42139935-42139957 CTGTATCAGTTTTTGATATAGGG - Intergenic
1055183773 9:73424793-73424815 GTGTTTCAGTGTCTTATTTATGG + Intergenic
1055919873 9:81448811-81448833 CTGCTTCAGAGAATGATTTAGGG + Intergenic
1059725066 9:117000137-117000159 CTGGTGCAGTGGATAATATATGG - Intronic
1059778365 9:117500154-117500176 CTGCTTCATTGTATGAAATACGG + Intergenic
1203674722 Un_KI270756v1:12270-12292 CTGTTTGAGTCTATGACATGTGG + Intergenic
1186418577 X:9405199-9405221 CTGTTTCATTGTTGGATAGAAGG + Intergenic
1186418808 X:9407175-9407197 CTGTTTCATTGTTGGATAGAAGG + Intergenic
1186418918 X:9408105-9408127 CTGTTTCATTGTTGGATAGAAGG + Intergenic
1186419030 X:9409037-9409059 CTGTTTCATTGTTGGATAGAAGG + Intergenic
1186419138 X:9409968-9409990 CTGTTTCATTGTTGGATAGAAGG + Intergenic
1186419367 X:9411944-9411966 CTGTTTCATTGTTGGATAGAAGG + Intergenic
1186716643 X:12259138-12259160 CTTCTTCAGTAAATGATATAGGG + Intronic
1187712815 X:22071301-22071323 GGATTTCATTGTATGATATAGGG + Intronic
1188809876 X:34640247-34640269 CTGTTTCCGTGTATGAATGAAGG - Intronic
1189238931 X:39510644-39510666 CTGTTTCAGTGCATGAGGTTTGG - Intergenic
1190749404 X:53348047-53348069 CTCTTTCAGTGCATCATATCAGG - Intergenic
1190796179 X:53745165-53745187 TTATTTCTGTGTAAGATATAAGG + Intergenic
1194007185 X:88509112-88509134 CTATTCCAGTGTAGGATATTTGG + Intergenic
1195742973 X:108084648-108084670 CTGTTTCAGAGAGGGATATAAGG + Exonic
1196512385 X:116527660-116527682 CTGTTTATGTGTAGGGTATAAGG + Intergenic
1198713626 X:139532734-139532756 CTCTTTAAATGTCTGATATAAGG + Intronic
1199402699 X:147417835-147417857 CTGTTTCATTATTTGAAATAGGG - Intergenic