ID: 1172822114

View in Genome Browser
Species Human (GRCh38)
Location 20:37746053-37746075
Sequence TACTTCCCACTTCAGATCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 118}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172822114_1172822123 22 Left 1172822114 20:37746053-37746075 CCCTTGATCTGAAGTGGGAAGTA 0: 1
1: 0
2: 1
3: 16
4: 118
Right 1172822123 20:37746098-37746120 TAGTAGGATAACTATGTTCAGGG 0: 1
1: 0
2: 0
3: 6
4: 134
1172822114_1172822117 -2 Left 1172822114 20:37746053-37746075 CCCTTGATCTGAAGTGGGAAGTA 0: 1
1: 0
2: 1
3: 16
4: 118
Right 1172822117 20:37746074-37746096 TAAGAGAAACCCTTTTTGGATGG 0: 1
1: 0
2: 1
3: 14
4: 229
1172822114_1172822118 -1 Left 1172822114 20:37746053-37746075 CCCTTGATCTGAAGTGGGAAGTA 0: 1
1: 0
2: 1
3: 16
4: 118
Right 1172822118 20:37746075-37746097 AAGAGAAACCCTTTTTGGATGGG 0: 1
1: 0
2: 0
3: 23
4: 236
1172822114_1172822122 21 Left 1172822114 20:37746053-37746075 CCCTTGATCTGAAGTGGGAAGTA 0: 1
1: 0
2: 1
3: 16
4: 118
Right 1172822122 20:37746097-37746119 GTAGTAGGATAACTATGTTCAGG 0: 1
1: 0
2: 0
3: 9
4: 70
1172822114_1172822116 -6 Left 1172822114 20:37746053-37746075 CCCTTGATCTGAAGTGGGAAGTA 0: 1
1: 0
2: 1
3: 16
4: 118
Right 1172822116 20:37746070-37746092 GAAGTAAGAGAAACCCTTTTTGG 0: 1
1: 0
2: 2
3: 18
4: 272
1172822114_1172822119 6 Left 1172822114 20:37746053-37746075 CCCTTGATCTGAAGTGGGAAGTA 0: 1
1: 0
2: 1
3: 16
4: 118
Right 1172822119 20:37746082-37746104 ACCCTTTTTGGATGGGTAGTAGG 0: 1
1: 0
2: 0
3: 7
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172822114 Original CRISPR TACTTCCCACTTCAGATCAA GGG (reversed) Intronic
905650419 1:39652806-39652828 TACTTCCCAATTAAGGTCAATGG + Intergenic
907049104 1:51317835-51317857 TACTTCCCACGTGAGATAACAGG + Intronic
907658839 1:56373024-56373046 TTCTTCCCATTTTAGAACAAAGG - Intergenic
908041405 1:60117679-60117701 AACTTCCCGCGTCAAATCAAAGG - Intergenic
908298262 1:62735225-62735247 TACTTCCCAAATCAGAGCACAGG + Intergenic
910070915 1:83212668-83212690 TCCTTCCCACTTTAGACAAAGGG + Intergenic
911497830 1:98651836-98651858 TTCTTCACATTTCATATCAATGG - Intergenic
912661431 1:111534616-111534638 TTCTTCCCACTTCAGGTCATGGG - Intronic
915610588 1:156988841-156988863 TTCTTCCTCCTTCAGTTCAATGG - Intronic
920659990 1:207907574-207907596 TACTTCCCAATTAAGCCCAAAGG + Intronic
1063525988 10:6786305-6786327 TCCTTCCCAGTTCAGAGCACAGG - Intergenic
1064205033 10:13316131-13316153 TACTTCCCACATCTGAGCTACGG - Intergenic
1064304334 10:14151869-14151891 GAGTTCCCACTTCAGCCCAAAGG + Intronic
1076164769 10:128272893-128272915 TATTTCTCAATTCAAATCAATGG - Intergenic
1076398713 10:130162527-130162549 AACTTACCACTTCAGTTGAATGG + Intronic
1078968363 11:16374181-16374203 TAATTCCCAGTTCAGTTCATAGG - Intronic
1080070066 11:28072074-28072096 TACTTGCCATTTTAGAGCAATGG - Intronic
1080916893 11:36668916-36668938 TACTTCCCTCTCAAAATCAAAGG + Intergenic
1081275029 11:41137837-41137859 TAATTTCTGCTTCAGATCAATGG - Intronic
1084143927 11:67253534-67253556 TACTGCCCACCGAAGATCAAGGG - Exonic
1084675836 11:70633887-70633909 TCCTTCCCACTTCCTATAAATGG - Intronic
1086116603 11:83257875-83257897 TCCTTCCCACTACAGAAGAAGGG - Intronic
1093354051 12:18141158-18141180 TACTCCCCAGTCCAGTTCAATGG + Intronic
1095145770 12:38724097-38724119 TACTTCCCATTTTAGATAAAAGG + Intronic
1095285162 12:40401983-40402005 TACATCGCACTTAAGAGCAAAGG + Intronic
1098220015 12:68259552-68259574 TACTTCCCACTTCTGCTCTAAGG + Intergenic
1099955269 12:89347165-89347187 TTCTCCCCACTTCACATGAAGGG + Intergenic
1099975593 12:89542685-89542707 TGCTTCCCTCTTCAGACCTAGGG - Intergenic
1106077329 13:26472052-26472074 TACTTCCCACTTCACATCATCGG - Intergenic
1109350885 13:61179648-61179670 TACTTCACATTTCAGTTCATAGG - Intergenic
1109895891 13:68689486-68689508 TTCATCCCACTTCAGATCTAAGG + Intergenic
1109982965 13:69934758-69934780 GCCTTCCCACTTCAGATCATTGG + Intronic
1111166160 13:84460404-84460426 TTCTTCCCACTTCAAACCAAGGG + Intergenic
1113538796 13:111090293-111090315 ACCTTCCCAATTCAGATGAAGGG + Intergenic
1115219093 14:31041489-31041511 TACTTCCCATTTCTAATAAATGG - Intronic
1115726107 14:36217725-36217747 TACTTGCCACTTCTGATTATTGG + Intergenic
1117571480 14:57053257-57053279 AAATTCCAATTTCAGATCAATGG + Intergenic
1117786556 14:59291901-59291923 CACTTCCCATTTAAGATCTAGGG + Intronic
1118996324 14:70839974-70839996 TACTTGCCACTTTAGATCAGGGG + Intergenic
1121605938 14:95240071-95240093 TACTACACACCTCAGATCTATGG - Intronic
1123828543 15:24108179-24108201 TACTTCACATGTCAAATCAAGGG - Intergenic
1124589664 15:31041848-31041870 TACTTCTCACTTAAGGACAATGG - Intronic
1125443945 15:39732989-39733011 TACCTCCCACATCAGATAAGAGG + Intronic
1126634454 15:50767215-50767237 CACCTCCCACTTCATAGCAAGGG + Intergenic
1127748722 15:62008664-62008686 TATTTACCACTTCATACCAATGG - Exonic
1127820367 15:62649482-62649504 TACTTCCTATGTCAGATTAAGGG + Intronic
1133012914 16:2924888-2924910 CACTTCCCACTTCTGTTTAAAGG - Intronic
1138986415 16:62334261-62334283 TGATTCCCACCTCTGATCAAGGG + Intergenic
1140220588 16:73040838-73040860 TACTTCCCACTACAAATGTAAGG + Intronic
1143604194 17:7972003-7972025 TTCTTCCCACTACAGATTCAGGG - Intergenic
1149154669 17:53612888-53612910 TACTTCTCACTTCATTTCATAGG + Intergenic
1150031583 17:61742487-61742509 TGCTTCCTACTTTAAATCAAAGG - Intronic
1156202211 18:34846768-34846790 ATCTTCTCACTTCAGAACAAAGG + Intronic
1158020861 18:52839937-52839959 TTCTTCCCACTACAGGCCAATGG + Intronic
1159598846 18:70409604-70409626 TACTTTGCACTTCAGGACAAGGG - Intergenic
1168519940 19:57041815-57041837 TACTTCCCACATGTGAGCAATGG + Intergenic
925783343 2:7404259-7404281 TATTTTCCACTTCAGCTCCAGGG + Intergenic
926760225 2:16271897-16271919 TACTTTCCTCTGCAGATCATGGG + Intergenic
926917901 2:17910571-17910593 TGCTTGCCATTTCAGATCACTGG + Intronic
928448282 2:31352771-31352793 AACTTCACACTTCAGATCTAGGG - Intronic
932072925 2:68638577-68638599 TAAGTCCCACTTCAAACCAAGGG - Intergenic
934013260 2:87849641-87849663 TACTTCACCCTTCATATCACAGG - Intergenic
937108074 2:119337762-119337784 TTATTCCCACTGCAGATGAAAGG + Intronic
944276435 2:197843740-197843762 TCCTTCCCCTTTCAGATCTAGGG - Intronic
946880741 2:224175138-224175160 TTCTTCTCAGTTCAGGTCAAGGG - Intergenic
946999748 2:225440240-225440262 TAATTCCACCTTCAGATCATAGG + Intronic
1169742079 20:8905957-8905979 TACTTCCCAATTCCGAACAATGG - Intronic
1172822114 20:37746053-37746075 TACTTCCCACTTCAGATCAAGGG - Intronic
1173115146 20:40234656-40234678 TCCTTTCTACTACAGATCAATGG - Intergenic
1173467562 20:43295522-43295544 TACCTCCCTCTTGAGACCAAAGG + Intergenic
1175535035 20:59704462-59704484 TTCTTTCCACTTCAGCTCATGGG + Intronic
1177018333 21:15818730-15818752 CAGTACCCACTTCAGGTCAATGG + Exonic
1178203169 21:30431540-30431562 TAATTCCCACTTAAGATCATTGG - Intergenic
1178532625 21:33387995-33388017 GAATTCCCAATTCAGATTAAGGG + Intergenic
1182428624 22:30287750-30287772 AACTTCCCACTTAAGATCAGAGG + Intronic
1182909400 22:33968927-33968949 TAATTCTAACTTCACATCAAAGG + Intergenic
951070620 3:18324669-18324691 TGCTTTCTACTTAAGATCAAGGG - Intronic
952420917 3:33130859-33130881 AAACTCCCATTTCAGATCAAGGG - Intronic
953348869 3:42199366-42199388 TCCTTCCCAGTCCAGATTAAGGG + Intronic
956423880 3:69112914-69112936 TTTTTCCCACTACACATCAAAGG + Intronic
957882066 3:86229825-86229847 AACTTTCCTCTTCAAATCAAGGG - Intergenic
958102012 3:89024111-89024133 GTCTTCCCCATTCAGATCAAGGG + Intergenic
958937854 3:100276848-100276870 TCCTTCCCACCTCAGAACCATGG + Intronic
958990009 3:100831921-100831943 TTCTTCCCACTTCTGATGTATGG + Intronic
962728946 3:138261835-138261857 AACTTCCCACTTCTGACGAAAGG - Exonic
966926661 3:184648785-184648807 TACTTCCCACCCCAGCTCCAGGG + Intronic
971260957 4:25056785-25056807 TACTTCCCACTTCAAATAGTAGG - Intergenic
976600970 4:86936663-86936685 TCCTTCCCACTAAAGATGAAAGG - Intronic
981123819 4:141082912-141082934 TTCTTCCATCTTCAGATGAAGGG + Intronic
982906918 4:161086005-161086027 TACTTCACACTTGAGATAATAGG - Intergenic
984426904 4:179598764-179598786 GAATTCCCACTTCAGCTCAGTGG - Intergenic
989469791 5:41801984-41802006 TAGTTGCCACTTCAGTTTAAAGG - Intronic
992888563 5:81183298-81183320 TATTTCTCACTTCTCATCAAAGG + Intronic
994046231 5:95313377-95313399 CTCTTCCCACTTCAGGTGAAAGG - Intergenic
994241920 5:97432478-97432500 TGCTTCCCCCTTTAGATCATAGG + Intergenic
998993387 5:147843916-147843938 TGCTTCCCACTTGAGGTAAAAGG + Intergenic
999241754 5:150131978-150132000 TCCTTCCAGCTACAGATCAATGG - Exonic
999335211 5:150710147-150710169 TAATTTCCCCTTCAAATCAATGG + Intronic
999710912 5:154317582-154317604 ACCTGCCCACTTCAGATCAGAGG + Intronic
1007412289 6:41671942-41671964 TGTTTCCAACTTCAGAACAAAGG - Intergenic
1011144073 6:84192464-84192486 TAATTAGCACTACAGATCAATGG + Intronic
1014199029 6:118588439-118588461 TACCTCCCACTTCAGCTGTAAGG - Intronic
1014680152 6:124418434-124418456 TAGTTCCCATTTCAGAATAAGGG - Intronic
1015675550 6:135743569-135743591 TTCTTCCCACCTCATACCAATGG - Intergenic
1018503393 6:164438109-164438131 GAGTTCCCACTTCAGATTAGGGG - Intergenic
1020495609 7:8849185-8849207 CACTTCCCACTGAAAATCAAGGG - Intergenic
1021609702 7:22445327-22445349 TATTTCTAACTTCAGATCAAGGG + Intronic
1027288638 7:76677533-76677555 TCCTTCCCACTTTAGACAAAGGG + Intergenic
1029432818 7:100542622-100542644 TCCTTCCCACAGCATATCAAAGG - Intronic
1030383861 7:108845119-108845141 TACTTCCCACAACACATGAAAGG - Intergenic
1031918382 7:127584098-127584120 TATTTCTCACTTCAGGTCAATGG + Intronic
1034060525 7:148083095-148083117 TACTGTCCACTCCAGATCAGTGG + Intronic
1035058942 7:156055097-156055119 TACTCCACACTCCAGCTCAAGGG - Intergenic
1039567592 8:38562503-38562525 TACTTCCCCCTCCAAATCCAGGG - Intergenic
1040511685 8:48101353-48101375 TACTTCCCAATTCAGCTGGATGG - Intergenic
1041995568 8:64053204-64053226 TGCTTCCCACTTCAGACCTATGG + Intergenic
1042058851 8:64795428-64795450 TAATTCCCACTTCACATTTATGG + Intronic
1043230811 8:77798588-77798610 TAATTCCCACTTCTCATTAATGG + Intergenic
1044742865 8:95345364-95345386 GACTTCACATTTCAGAGCAAAGG + Intergenic
1046242727 8:111517913-111517935 TAATTACCACTTAAGATCATGGG + Intergenic
1046693174 8:117308786-117308808 TTCTCTCCACTACAGATCAAGGG - Intergenic
1047114862 8:121830054-121830076 TACTTCCCACTGCAGTTTCAAGG - Intergenic
1047986984 8:130245464-130245486 TACTTCACAGTTCAGATCCTTGG + Intronic
1050961139 9:11733712-11733734 TCCTTCCTACTTCAGCTCCAAGG + Intergenic
1052643198 9:31195840-31195862 TGCTTTCTACTTTAGATCAAAGG - Intergenic
1058794254 9:108483022-108483044 TACTTCTCACCTCAGAGCACAGG - Intergenic
1060656229 9:125374441-125374463 TTCTACCCACTGGAGATCAAGGG - Intergenic
1190137490 X:47809801-47809823 TAACTCCGACTTCTGATCAAAGG + Intergenic
1190561274 X:51687776-51687798 GACTTCCCACTTTACATGAATGG + Intergenic
1190563017 X:51705541-51705563 GACTTCCCACTTTACATGAATGG - Intergenic
1191795380 X:65016261-65016283 TGATTCCCACTTAAGATCATTGG - Intronic
1191803837 X:65111930-65111952 TATTTCTCACTTTAGATCAAAGG + Intergenic
1192007894 X:67236744-67236766 AACTCCCCACCTCAAATCAATGG + Intergenic
1193368433 X:80662731-80662753 TACTTTCCTTTTAAGATCAAGGG - Intergenic
1199026733 X:142948049-142948071 AATTTCTCACTTCAGAGCAAGGG + Intergenic
1199131211 X:144188828-144188850 TACTTCACCCTTCATATCACAGG + Intergenic