ID: 1172826354

View in Genome Browser
Species Human (GRCh38)
Location 20:37790385-37790407
Sequence GTGCAAAAGCAAAATTATAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 492
Summary {0: 1, 1: 1, 2: 5, 3: 33, 4: 452}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172826350_1172826354 -1 Left 1172826350 20:37790363-37790385 CCTCCAGTCTCCCAGGATTCAAG 0: 1
1: 0
2: 0
3: 26
4: 184
Right 1172826354 20:37790385-37790407 GTGCAAAAGCAAAATTATAATGG 0: 1
1: 1
2: 5
3: 33
4: 452
1172826351_1172826354 -4 Left 1172826351 20:37790366-37790388 CCAGTCTCCCAGGATTCAAGTGC 0: 1
1: 0
2: 1
3: 13
4: 164
Right 1172826354 20:37790385-37790407 GTGCAAAAGCAAAATTATAATGG 0: 1
1: 1
2: 5
3: 33
4: 452

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172826354 Original CRISPR GTGCAAAAGCAAAATTATAA TGG Intronic
900912376 1:5609605-5609627 ATCCAAAAGAAAAATTAAAATGG - Intergenic
902155601 1:14483091-14483113 GAGCAAAATCAGAATAATAATGG - Intergenic
902175013 1:14642816-14642838 GTTTAAAAACAAAAATATAAGGG + Intronic
902270274 1:15299362-15299384 CTGCAAAAGCAAAACTATGAGGG - Intronic
907222816 1:52919949-52919971 GTGTAAACACAAAATTATCATGG - Intronic
908359907 1:63358669-63358691 ATGATAAAGCAAAATTAAAATGG - Intergenic
909231836 1:73101295-73101317 ATGCAAAAGAAAAATCTTAAAGG + Intergenic
909345130 1:74576229-74576251 GTGCACAAGGAAGATTATTAGGG - Intronic
909856541 1:80539986-80540008 TTCCAAAACCATAATTATAAGGG - Intergenic
909856770 1:80544198-80544220 ATGGAAAAGCAAAATTTAAATGG + Intergenic
910910758 1:92231431-92231453 GTGGAAAAGAAAAAATAAAATGG + Exonic
911669992 1:100597110-100597132 ATGCAAAAGCTGATTTATAAAGG - Intergenic
911708844 1:101045424-101045446 TTGCAAAACCTAAATTATATTGG + Intergenic
911798414 1:102103023-102103045 GTGCTAGAGCAAAATTAAAAGGG - Intergenic
911803329 1:102173653-102173675 TTGGAAAAGAAAAATTAGAATGG + Intergenic
913362016 1:117991718-117991740 GTGCAAAAGCAAAGCTTTAAGGG + Intronic
915047402 1:153029872-153029894 GGGCAACAGCCAAATCATAATGG + Intergenic
915257565 1:154646215-154646237 GAGCAAAAGCGAAATTGGAAGGG - Intergenic
915986233 1:160468132-160468154 GAGGAAAAGCAAATTTAAAAAGG - Intergenic
916537144 1:165714200-165714222 GTGCAAATAAAAAATTCTAAAGG + Intergenic
916671200 1:167022385-167022407 ATGCGAAGGCAAAATTAGAAAGG + Intergenic
916685934 1:167146445-167146467 ATGCAAAAGGAAATTTAAAAAGG - Intergenic
916886791 1:169077152-169077174 GACCAAAAGAAAAATTAAAATGG + Intergenic
917876490 1:179291426-179291448 GTGCAAAGGCAAGATAATGAAGG - Intergenic
918615415 1:186538893-186538915 GAGAAAAAGAAAAATTATATGGG + Intergenic
918631158 1:186719951-186719973 TTGCAAAAACAAAAATAAAAAGG - Intergenic
919049139 1:192491614-192491636 GTATAAAAGCAAAATAATAGAGG + Intergenic
919185577 1:194143487-194143509 TTCCAAAAGAAAAATTAAAAGGG - Intergenic
919564811 1:199171232-199171254 GTGAAAAAGAAAAAATATAAAGG + Intergenic
919836439 1:201577548-201577570 GTGCAAAAGTAATTTAATAAAGG - Intergenic
924352061 1:243124914-243124936 ATGTAAAAACAAAACTATAATGG - Exonic
924797887 1:247305648-247305670 GTGAAAAACCAAAATGATAAAGG + Intronic
1065500269 10:26374214-26374236 TTGTAAAAAGAAAATTATAAAGG + Intergenic
1066141063 10:32505138-32505160 GGGCATAAAAAAAATTATAAAGG - Intronic
1068367797 10:56074062-56074084 ATGAAAAAGTAAAATTAAAAGGG - Intergenic
1068450838 10:57185310-57185332 GTGCAACAGAAAAATATTAATGG - Intergenic
1068611891 10:59069472-59069494 CTGCACTAGCAAAATTCTAATGG - Intergenic
1069108467 10:64412798-64412820 GTACAAAAGCAAAACTGTTATGG + Intergenic
1069520927 10:69120537-69120559 GTTCTATAGCAAAATAATAATGG - Intergenic
1070243836 10:74711242-74711264 GAGAAAAAGCAAAATTATCTGGG + Intergenic
1071574898 10:86718123-86718145 GTGCAACACCAAAATTATGGGGG + Exonic
1071788657 10:88931571-88931593 GTTCAAAAGAAGAATTATATGGG - Intronic
1071856713 10:89633234-89633256 GTGCTAAAGCCAACTTATACAGG - Intronic
1073388121 10:103145091-103145113 GTGCATAAGCAAAGCTATAATGG + Intronic
1073684946 10:105742016-105742038 GTTCCAAAGCAATATTATATAGG + Intergenic
1073885629 10:108036521-108036543 GTGATAAATCAAAATTATTATGG - Intergenic
1074010884 10:109478280-109478302 TTGCAAACACAAAATTATACAGG - Intergenic
1074678387 10:115878959-115878981 GAGGAAGAGAAAAATTATAATGG + Intronic
1075111742 10:119592575-119592597 GAACAAAAGCAAAACTATTATGG - Intronic
1076204358 10:128584157-128584179 CAACAAAAGCAAAACTATAAAGG - Intergenic
1076286400 10:129301711-129301733 TAGAAAAAGCAAAACTATAAGGG + Intergenic
1078186604 11:9056921-9056943 ATGAAAAAGCAAAATAAAAAAGG + Intronic
1079052317 11:17172937-17172959 GTGAAAAAAGAAAATTAAAATGG - Intronic
1080019153 11:27541247-27541269 TTGCAAAAGCAATTTCATAAAGG + Intergenic
1080519425 11:33054166-33054188 GTGCAAAAGTAAACTGCTAATGG + Intronic
1081032698 11:38106532-38106554 CTGGAAAAGAAAAATTAAAATGG - Intergenic
1081246051 11:40767981-40768003 GAGCAGAAGCAAAATTGAAAGGG + Intronic
1086029413 11:82335942-82335964 GTGCAAAAGTAAAAATACATAGG + Intergenic
1086304815 11:85468160-85468182 ATGCAAAAAAAAAATGATAAAGG - Intronic
1086819124 11:91413312-91413334 GTGCAAATGCAAAATGCTACAGG + Intergenic
1087417826 11:97880709-97880731 GTGCAAAAGCAATTTTTGAAAGG + Intergenic
1087961785 11:104360294-104360316 GTGAAAAAGCCAATTTCTAAAGG + Intergenic
1088220718 11:107567319-107567341 GTGCAGAAGCAGAATTGCAATGG - Intergenic
1089906850 11:122048872-122048894 GAGCAAAAACAAAAATAGAAGGG + Intergenic
1090863475 11:130674713-130674735 CTGCAAAAACAAAAATACAATGG - Intronic
1092608928 12:10151927-10151949 ATGCAAAAGAAAAAATGTAAAGG - Intergenic
1093674537 12:21921727-21921749 GTACAAAAACAAAATCAAAATGG - Intronic
1093688990 12:22088225-22088247 GTGAAACAGCTAAATGATAATGG + Intronic
1094208800 12:27868891-27868913 TTGAAATAGGAAAATTATAATGG + Intergenic
1094417787 12:30235660-30235682 AGACAAAAACAAAATTATAAAGG - Intergenic
1094594264 12:31849680-31849702 GTGAAATAGGAAAATTCTAAAGG + Intergenic
1094699590 12:32856041-32856063 GAACAAAACCAAAATGATAATGG + Intronic
1094859180 12:34440918-34440940 GTGAAAAAGCAAATTTCTGAGGG - Intergenic
1095371999 12:41478923-41478945 GTTCCAAATCAAAATTCTAAGGG + Intronic
1095636762 12:44443613-44443635 CTACAAATGTAAAATTATAATGG + Intergenic
1097238052 12:57553081-57553103 GTGCAAAAGCAAAACAAGATGGG - Intronic
1097372598 12:58802498-58802520 GTGCAAAAGCAAAAATAATTTGG + Intronic
1098059783 12:66549286-66549308 GTGCAGAAGCAAAATGATAAAGG + Intronic
1098204382 12:68092656-68092678 GTCCAAAATCATAATTACAAAGG + Intergenic
1098666124 12:73164884-73164906 GTGCTAAAGAAAAATTAAAATGG - Intergenic
1099411546 12:82335071-82335093 CTGCAAAAACAAAAATATTATGG - Intronic
1099637256 12:85229550-85229572 CTGCAAATGAAAAATTAGAACGG + Exonic
1100493464 12:95102773-95102795 GGACGTAAGCAAAATTATAAAGG + Intronic
1100671429 12:96817207-96817229 TTGCAAAAGCACAATAAAAAAGG - Intronic
1102141604 12:110619712-110619734 GTGCAATAGGAAAAATAAAATGG + Intronic
1102649410 12:114427962-114427984 ATGCAAAAATAAAATTCTAAAGG - Intergenic
1103264130 12:119614674-119614696 GTTCAAAAGCAACTTTCTAAGGG - Intronic
1103886168 12:124202261-124202283 GTGAAAAACAATAATTATAAGGG + Intronic
1104848637 12:131860234-131860256 GTACAAAAACAAAATTATCTGGG + Intergenic
1105624188 13:22097253-22097275 ATGCAAAAGGAAAATTAAAATGG - Intergenic
1106816401 13:33412435-33412457 ATGGAAAACAAAAATTATAATGG + Intergenic
1107007914 13:35635500-35635522 ATTCAAAAGCCAAATTAAAATGG + Intronic
1107533186 13:41304025-41304047 AAGCAAAAGCAAATTTATTAAGG - Intergenic
1107668825 13:42721740-42721762 CTGCAAATGCAAATATATAAAGG + Intergenic
1107824055 13:44311768-44311790 GGGGAAAAGCAAGATTATAAAGG + Intergenic
1108777083 13:53779869-53779891 GTCCAAGAGAAAAATTATGAGGG + Intergenic
1108964587 13:56282052-56282074 GTGCAAAAGCATTCTTACAAAGG + Intergenic
1109093868 13:58085882-58085904 GTGAAACAGCAAATTTGTAAAGG - Intergenic
1109216340 13:59593928-59593950 GTGCAATAAAAAAATGATAAAGG + Intergenic
1109254677 13:60064724-60064746 ATGCAAAGGAAAAATTCTAAAGG - Intronic
1109729997 13:66400526-66400548 CTGCAAATGCAAATTTATAAAGG - Intronic
1110064256 13:71083190-71083212 TTAAAAAAGAAAAATTATAAAGG - Intergenic
1111286831 13:86104838-86104860 GAGAAAAAGAAAAATGATAAAGG - Intergenic
1111379769 13:87433894-87433916 ATGCAAATTCATAATTATAATGG - Intergenic
1111618000 13:90685979-90686001 GTGCCAATGGAAAACTATAATGG + Intergenic
1112424470 13:99285205-99285227 ATGCAAAAGCAAATGTAAAAGGG - Intronic
1114421072 14:22583183-22583205 GTTCAAAACTAAAAATATAAAGG + Intronic
1114692479 14:24596888-24596910 AAGCAAAAGCAATATTAAAAGGG - Intergenic
1114743608 14:25123108-25123130 ATGCAAATTCAAAACTATAAAGG - Intergenic
1114857770 14:26470747-26470769 CTTCAAAGGCAAAATTATTAAGG + Intronic
1114857891 14:26473491-26473513 GAGCAAAAGCATAACTTTAAAGG + Intronic
1114912705 14:27220454-27220476 GGGCAAAAGAAAAATGAAAAAGG + Intergenic
1115630248 14:35237629-35237651 GTGAAAAGGCAAAATTGGAAAGG - Intronic
1115871453 14:37808688-37808710 GTGAGAAAGGAAAATCATAATGG - Intronic
1116269604 14:42744572-42744594 ATGCAAAAATAAAATTAAAATGG + Intergenic
1116413815 14:44656761-44656783 GTGTAAAAGCAAGATTTAAAAGG + Intergenic
1116501017 14:45622088-45622110 TTCCAAAAGTAAAATTAAAATGG + Intergenic
1116551193 14:46241007-46241029 ATACAAAAGCAAAACTACAAAGG + Intergenic
1116763797 14:49046628-49046650 GTGCAAAACTGAAATTTTAATGG + Intergenic
1117303495 14:54451006-54451028 ATGCAAAAGCAAAGATAAAAAGG + Intergenic
1117335745 14:54755756-54755778 GTGGAAAAGGAAAATTAGAATGG + Intronic
1117859138 14:60071559-60071581 GTGTAGAAGCAAAAGTATAAGGG + Intergenic
1118058666 14:62110884-62110906 CTTCAAAAGAAAAATAATAAAGG - Exonic
1120269748 14:82296371-82296393 GTGCAAAAACAGAATAATAGAGG - Intergenic
1121834736 14:97081743-97081765 TTGAAAAGGCAAAATTATAAGGG - Intergenic
1122253788 14:100461996-100462018 GTGCAAAAACAAAATCCCAAAGG - Intronic
1123104543 14:105833673-105833695 GTGGCAAAGCAAAATTTTTATGG + Intergenic
1124276947 15:28333936-28333958 GTGCAAAACCAAAATTCACATGG - Intergenic
1124305753 15:28577670-28577692 GTGCAAAACCAAAATTCACATGG + Intergenic
1124697194 15:31874111-31874133 GAGAAAAAGGAAAATTATCAGGG - Intergenic
1125328577 15:38561878-38561900 CTCTAAAAGCAAAATAATAATGG + Intronic
1125833166 15:42730296-42730318 TTGCAAAAGCAGAACTAAAAGGG + Intronic
1126593203 15:50360055-50360077 CTGTAATAGCTAAATTATAATGG + Intergenic
1127246296 15:57179051-57179073 GTGAAAAAGAAAAATTAAGATGG + Intronic
1129146417 15:73651870-73651892 GTGCAAAATCAAATTAATAGTGG - Intergenic
1130327642 15:82894101-82894123 GTGAAAAAGCAACAATATAGAGG - Intronic
1131561195 15:93441736-93441758 GTGTAAAAGCAAAACTTGAAAGG + Intergenic
1131940636 15:97561065-97561087 GTGCAAAAGACAAAGTTTAACGG - Intergenic
1133068692 16:3230661-3230683 TTGCAAAGGAAAAACTATAACGG - Intronic
1133700006 16:8300027-8300049 GAGAAAAAGCAAGATTAAAATGG + Intergenic
1133951253 16:10395157-10395179 GTTAAAAAAAAAAATTATAAGGG + Intronic
1134899953 16:17928665-17928687 GTTAATAAGGAAAATTATAATGG - Intergenic
1137030800 16:35522429-35522451 GTGCAGAAGCAAAAACATATTGG + Intergenic
1137304193 16:47182604-47182626 GTACAAAAACGAAAATATAATGG + Intronic
1139197092 16:64932203-64932225 GTGCAGAAACAAAGTTAGAAAGG - Intergenic
1139877931 16:70161353-70161375 GTGCAGCAGGAAAATTAGAATGG - Exonic
1140166841 16:72561468-72561490 TCGCAAATGCAAAATTATCAGGG + Intergenic
1140618609 16:76698623-76698645 GTGCAAATGCAATTTGATAAAGG - Intergenic
1141463039 16:84189267-84189289 TTACAAAAGCAAATTGATAATGG - Intergenic
1144133547 17:12270903-12270925 GAGCAAATGCAAAATTAGGAAGG - Intergenic
1146124864 17:30223587-30223609 GTGGAAAATAAAAATTTTAAAGG + Intronic
1148375723 17:47143980-47144002 GTACTAAAAAAAAATTATAAAGG + Exonic
1149464905 17:56870443-56870465 CTGTCAAAGCAAAATTAAAATGG - Intergenic
1149917907 17:60628555-60628577 TGGAAAAAGCAAAATTATGAAGG - Intronic
1150771047 17:68041236-68041258 GTGCAGAAGAAAAATTTCAATGG + Intronic
1152114371 17:78376261-78376283 GTGTAAAAGCCAAATTACCAAGG - Intergenic
1153193047 18:2563898-2563920 ATGAAAAAGCAAAATATTAATGG - Intronic
1156544941 18:37955242-37955264 GTGCAAAAGGAAAAGTTTGATGG - Intergenic
1156689452 18:39689515-39689537 GTGCAATAGAAAAATGAGAAAGG + Intergenic
1157671937 18:49537982-49538004 TTGTTAAAGCAAAATTAAAATGG + Intergenic
1157874974 18:51264121-51264143 GTGGAAAAGTCATATTATAATGG - Intergenic
1158197230 18:54901858-54901880 GTGAAAAAACAAGATTACAAGGG - Exonic
1159676663 18:71292453-71292475 GTGCCAAACCAAGATTTTAAAGG - Intergenic
1159677614 18:71305319-71305341 GTGTCAAAGAAAAATTACAATGG - Intergenic
1160184123 18:76661406-76661428 GTGGAAAAGCAAATTAATAGAGG + Intergenic
925662571 2:6218434-6218456 GTGAAAAAGCCAAATCATAGAGG - Intergenic
926963352 2:18383275-18383297 GATCAAAATGAAAATTATAAGGG + Intergenic
927313917 2:21660193-21660215 GATCAAAAGCAAAAAGATAAAGG + Intergenic
927569568 2:24146056-24146078 CTGTAAAAGCAAAATTATACTGG + Intronic
927768894 2:25840859-25840881 GAGCCAAAGGAAAAATATAAAGG + Intronic
928930152 2:36615999-36616021 GAGTAAAAGCCAAATTGTAAGGG + Intronic
928948863 2:36796788-36796810 TTTAAAAAGCAAAAATATAAAGG - Intronic
929313169 2:40448828-40448850 GGGCAAAAACAAAAAGATAAAGG + Intronic
929321817 2:40552957-40552979 GTCCAAAAGCAAAGTTATATTGG + Intronic
929606029 2:43234811-43234833 GGGCAAAAACAAAATTATCTGGG - Intronic
930109250 2:47664612-47664634 AGGCAAAAGCAAAAGTAAAAAGG - Intergenic
930966842 2:57339140-57339162 ATAAAAAAGTAAAATTATAAAGG - Intergenic
931933089 2:67162954-67162976 GTACAACATCAAAATTCTAAAGG - Intergenic
932125886 2:69145281-69145303 ATACAAATGCAAAATTATAAGGG - Intronic
933334311 2:80937221-80937243 GTGAAAGAGTGAAATTATAAAGG + Intergenic
936767270 2:115868108-115868130 AAGCAAAAACAAAATTAAAAAGG + Intergenic
937435390 2:121875936-121875958 GAGCAAAAAAAAAATTAAAAAGG - Intergenic
937768612 2:125692631-125692653 GTACAAAAGCAATTTAATAACGG + Intergenic
938470751 2:131558414-131558436 GTGTAAAAGCTTAATTAAAAGGG + Intergenic
939537885 2:143455075-143455097 AAGCAAAAGCAAGATTATTAAGG + Intronic
940158961 2:150691441-150691463 GTGAAAAAGCAAAGTGACAATGG - Intergenic
940433996 2:153629196-153629218 ATGCAAAAAAAAAATGATAAAGG - Intergenic
941202752 2:162533042-162533064 GAGCAAAAATAAAATTATTACGG - Intronic
941421089 2:165283573-165283595 TAGCAATAGCAAGATTATAAGGG + Intronic
941637622 2:167952411-167952433 GAGCAAAAGCAAAAATAAAATGG - Intergenic
941789079 2:169531206-169531228 GAGGAAAAGCAAAGTTACAAAGG + Intronic
942179268 2:173364602-173364624 TTACAAAAGCAAAATTAAGATGG + Intronic
942516527 2:176759366-176759388 GTACAAAATCACAATTATACAGG - Intergenic
942937975 2:181581536-181581558 GATCAAAAGCAATATTATATAGG + Intronic
943822005 2:192336421-192336443 GTGAAAATTCAAAATTATTAGGG - Intergenic
944356941 2:198801502-198801524 TGGGAAAAGCAGAATTATAAAGG - Intergenic
945483559 2:210369079-210369101 AAGAAAAAGAAAAATTATAAAGG - Intergenic
946603424 2:221375648-221375670 TACCAAAAGCAAAATTATGAAGG - Intergenic
946704041 2:222439732-222439754 TTGAAATGGCAAAATTATAAAGG + Intronic
946896078 2:224325915-224325937 GTGTAAAAGCAAGATAACAATGG + Intergenic
947314096 2:228836275-228836297 GTGGCAAAGCAAAGTTATAAAGG - Intergenic
947465974 2:230347007-230347029 ATGCCAAAGCAAACCTATAAAGG - Intronic
947592756 2:231394955-231394977 GTGCACAAGCAGACTAATAAAGG + Intergenic
948298740 2:236885862-236885884 AGGCAAAAACAAGATTATAAAGG - Intergenic
1169099948 20:2938687-2938709 CAGCAAAAGAAAAATGATAAAGG - Intronic
1169234496 20:3919373-3919395 GTGCAATAGAAAAAATATAGAGG - Intronic
1170303825 20:14916251-14916273 GTGTAAAAGGAAAGTTCTAATGG - Intronic
1170530851 20:17289763-17289785 TTTCAAAAGCTATATTATAAAGG - Intronic
1171464488 20:25318013-25318035 GTACAGAAACAAAAATATAAAGG + Intronic
1172017583 20:31887190-31887212 TTGCAGAACCAAAATTACAAGGG + Exonic
1172227973 20:33317794-33317816 GTGCAAAAGAAAAAATACAGTGG - Intergenic
1172826354 20:37790385-37790407 GTGCAAAAGCAAAATTATAATGG + Intronic
1175603781 20:60296190-60296212 GTGCAAAAGGAACATAAAAAAGG - Intergenic
1176345525 21:5741895-5741917 GTGCAAAAACTAAATCAAAATGG - Intergenic
1176352339 21:5862479-5862501 GTGCAAAAACTAAATCAAAATGG - Intergenic
1176499302 21:7582560-7582582 GTGCAAAAACTAAATCAAAATGG + Intergenic
1176539846 21:8139965-8139987 GTGCAAAAACTAAATCAAAATGG - Intergenic
1176558797 21:8323010-8323032 GTGCAAAAACTAAATCAAAATGG - Intergenic
1176992049 21:15508683-15508705 GAGCAAAAGCCAAATTGAAAGGG + Intergenic
1177509786 21:22070699-22070721 ATACAAAAGCAAAAATAAAAGGG + Intergenic
1177608831 21:23419520-23419542 GTACCAGAGGAAAATTATAAAGG + Intergenic
1178106561 21:29325615-29325637 CTACAAAAGCAGAATTTTAAAGG - Intronic
1178737877 21:35168960-35168982 GTGCAAAAGCAAAGTGTTTATGG - Intronic
1179709193 21:43203084-43203106 AGGCAAAAGCAAAATAAAAAAGG - Intergenic
1182531967 22:30967730-30967752 GTGAAAAAGCAAAATTTTCTGGG + Exonic
1183639226 22:39083170-39083192 TTACAAAACCACAATTATAAAGG - Intronic
1184292896 22:43507670-43507692 GTGGAAAAGAAAAGTTATGAAGG + Exonic
1184322139 22:43750074-43750096 GTGCAAACGCAAGATTGTAGGGG - Intronic
1184395907 22:44240047-44240069 GTGCAAAAGCAGTTTGATAAGGG - Intergenic
1203244797 22_KI270733v1_random:56320-56342 GTGCAAAAACTAAATCAAAATGG - Intergenic
949126883 3:456049-456071 GTGCAAAGTAAAAATTAGAAAGG - Intergenic
949203847 3:1414413-1414435 GAGCATAAGCAAAATTCTAAAGG - Intergenic
949738961 3:7207840-7207862 GTTCAAAAGCAAAATGAAAATGG + Intronic
951196745 3:19832111-19832133 TAGCAAAAACAAAAATATAATGG - Intergenic
951240718 3:20283222-20283244 GGGCAAAAGCAGAATTATAACGG - Intergenic
951363859 3:21756660-21756682 GAGCAAAAGCACAAGTATATGGG + Intronic
951971526 3:28450485-28450507 ATGCCCAAGAAAAATTATAATGG - Intronic
952053424 3:29414194-29414216 GTGCAAAATCAAAAACAAAAAGG + Intronic
952078911 3:29732922-29732944 GTGAATAAGCAATATCATAAGGG - Intronic
952174783 3:30850112-30850134 CTGCAAAAACAAAATTAAAATGG + Intronic
952418792 3:33113513-33113535 GTGCAAAAATAAAATTAATAAGG - Intergenic
952540338 3:34360725-34360747 ATGGAAAAACAAATTTATAATGG - Intergenic
952715456 3:36475707-36475729 GTCCACAAGCAAAATTATAAAGG + Intronic
953144770 3:40264393-40264415 GAGCAAATGAAAAATTGTAAAGG + Intergenic
954596375 3:51829130-51829152 CTACAAAAGCAGAATTGTAAAGG + Intronic
954984653 3:54779064-54779086 GGGCAAAAGTAACATCATAACGG - Intronic
955610928 3:60756478-60756500 GAGCAAATTCAACATTATAAAGG + Intronic
955934309 3:64088122-64088144 CTGAAAAAGCAAAGTAATAAAGG + Intergenic
956490668 3:69768147-69768169 GTGCATGAGCAAAATTCTTAGGG + Intronic
956772799 3:72540708-72540730 GAACAAAAGCAAAAATATAGGGG + Intergenic
956870137 3:73408598-73408620 GTGCAACAGAAAAATTTTACAGG + Intronic
957436136 3:80178666-80178688 GTGTAAAAGTACAATTATATTGG - Intergenic
957460614 3:80514261-80514283 TTGCAAAAGTAAGATAATAATGG - Intergenic
958105547 3:89067991-89068013 TTGCAAAAGAAATATGATAAGGG + Intergenic
958915131 3:100041289-100041311 TTAGAAAAGCAAAATTATGATGG + Intronic
959877579 3:111403194-111403216 CAGCAAAAGCAGAATTAAAAGGG - Intronic
960218581 3:115074879-115074901 GTGTAAAAGAAAAAATAAAAAGG - Intronic
961419373 3:126788675-126788697 ATGCAATAAAAAAATTATAAAGG - Intronic
961841736 3:129719853-129719875 GTGGGAAATCCAAATTATAAAGG - Intronic
963279476 3:143368252-143368274 GAGCAACAGAAAAATTATGATGG + Intronic
963528359 3:146442793-146442815 ATACAAAAGTAAAATTAAAATGG + Intronic
963578758 3:147097385-147097407 TTCTGAAAGCAAAATTATAATGG + Intergenic
964513949 3:157485990-157486012 TGGCAAACCCAAAATTATAATGG + Intronic
964554506 3:157921380-157921402 GTACAAAAGATAAATTACAACGG + Intergenic
964691835 3:159458842-159458864 GTGAAAAAACAAAATCCTAAGGG + Intronic
965215612 3:165860814-165860836 GTGCAAAAGAATTTTTATAAAGG - Intergenic
966252073 3:177877405-177877427 GGGCAAAAGCAAGATCATCAGGG + Intergenic
966661751 3:182422179-182422201 GTGAAAAAGCACAATGATATAGG - Intergenic
967066331 3:185920315-185920337 TTTTAAAAGCAAATTTATAATGG - Intronic
968697069 4:2036215-2036237 ATTCAAAAGCAAAAATATACTGG + Intronic
968791821 4:2670196-2670218 GCTCAAAAGCAAACTTAAAATGG - Intronic
970070831 4:12157988-12158010 ATGCAATAACAAAATGATAAAGG - Intergenic
970685978 4:18567725-18567747 GTGTAAAATAAAAATTATACTGG + Intergenic
972906782 4:43759852-43759874 GGGTAGAAGCAAAATTTTAAGGG - Intergenic
973276649 4:48317417-48317439 GTGGACAAACAAAATGATAAAGG - Intergenic
974162058 4:58152808-58152830 GTGCAATAAAAAAATGATAAAGG + Intergenic
974550813 4:63371297-63371319 GTGTAAAATAAAAATAATAATGG - Intergenic
975188210 4:71428363-71428385 GTTTAAAAGGAAAATTATTATGG - Intronic
975421721 4:74172192-74172214 GTGGAATGGCAAAATTTTAAAGG + Intronic
975535822 4:75449001-75449023 GTGCAAAAGCAATGTAATAGAGG + Intergenic
975570758 4:75815481-75815503 GTGCAAAAGCAAAGTGAGAAAGG - Intergenic
976642790 4:87356733-87356755 GTTAAAAAATAAAATTATAAAGG - Intronic
977134457 4:93285307-93285329 TTGCAAAAGCAGAAGTATCAGGG - Intronic
977269634 4:94900418-94900440 TTGTAAATGCAAAATTGTAAAGG + Intronic
977377267 4:96221376-96221398 CTGTAAATGCAAAATGATAAAGG + Intergenic
977741512 4:100489479-100489501 ATGCAAGAGCAAGATGATAAAGG + Intronic
978181995 4:105809531-105809553 GTTAAAAAGAAAAATTAGAAAGG - Intronic
978308539 4:107359685-107359707 ATGCAAAAGTAAAATGATATTGG - Intergenic
978457958 4:108915782-108915804 TGGAAAAAGCAAAATTGTAATGG + Intronic
978566547 4:110088491-110088513 GTGCAACAGCAAAACTAGCATGG + Intronic
978731052 4:112026876-112026898 GTACAAAAACAAGATTACAAGGG + Intergenic
979177560 4:117682998-117683020 ATGCAATAGAAAAATGATAAAGG - Intergenic
979249880 4:118555614-118555636 ATGTAAAAACAAAACTATAATGG + Intergenic
979911797 4:126376361-126376383 TTGAAAAAGCAAAATCAAAAGGG - Intergenic
979952815 4:126915719-126915741 GGACAAATGTAAAATTATAAGGG + Intergenic
980260950 4:130446960-130446982 GTGCAAAACCAAAATTGTCATGG - Intergenic
980564200 4:134517432-134517454 GTCCCAAAGTAAAATGATAAGGG + Intergenic
980793441 4:137649918-137649940 GCGGAAATGCAAAATGATAACGG + Intergenic
981291421 4:143081015-143081037 GGGAAAAATCAAAATTATATAGG + Intergenic
981669042 4:147264651-147264673 GGGAAAAAGCAAAAATAGAATGG - Intergenic
981697173 4:147570638-147570660 GTGCCAGAGCCAAAGTATAACGG + Intergenic
982468817 4:155761222-155761244 AAGCAAAATAAAAATTATAATGG - Intronic
982483746 4:155941891-155941913 GTGAAAAAGTAAAATGAAAATGG - Intronic
983352963 4:166617450-166617472 CAGCAAAAGCAATACTATAAGGG + Intergenic
983481349 4:168278271-168278293 GTGCAACAGCAAAACTAGCACGG - Intronic
983655748 4:170082050-170082072 GTGCAAAAGAAAACTTTTCAAGG + Intronic
984125032 4:175797740-175797762 TTTCAAAGGCAAAATTATAGCGG + Intronic
984546146 4:181105742-181105764 AAACAAAAGCAAAATTACAAAGG + Intergenic
985072238 4:186177904-186177926 GAGAGAAAACAAAATTATAATGG + Intergenic
985377039 4:189351969-189351991 ATGCAGAAGAAAAATTATATAGG + Intergenic
985753085 5:1693970-1693992 GTTTAAAACAAAAATTATAAGGG - Intergenic
986129999 5:4920910-4920932 ATGCAAAATAAAATTTATAAAGG + Intergenic
986927540 5:12775255-12775277 GTGCAAAAGCAAAATCATAAAGG + Intergenic
987178530 5:15342009-15342031 GTGCAAAAGTAAAAGAACAATGG - Intergenic
987182519 5:15382986-15383008 GTTCAAAAACAAAATTGTCATGG - Intergenic
987459918 5:18196992-18197014 TTGCAAAACCAAAATAAAAAAGG + Intergenic
987723436 5:21666687-21666709 AGGGAAAAGCAAAATTATATAGG - Intergenic
987734016 5:21815443-21815465 GTGAGAAAGAAAAATTATAATGG - Intronic
988979456 5:36552122-36552144 TTTTAAAAGCAAATTTATAAAGG - Intergenic
989325650 5:40190543-40190565 GTGCAAGAGTAATATAATAAGGG + Intergenic
989504552 5:42212255-42212277 CAGCAAAAGCAATATTAGAAGGG - Intergenic
990127233 5:52533744-52533766 ATGCAAATGCAAAACCATAATGG + Intergenic
990272889 5:54164097-54164119 TAGCAAAAGAGAAATTATAAAGG - Intronic
990547819 5:56840848-56840870 ATGCAAATGCAAAATTGTTAAGG + Intronic
991040284 5:62168269-62168291 GTGCTGTAGCACAATTATAAGGG - Intergenic
991056973 5:62331592-62331614 GAAAAAAAACAAAATTATAAAGG + Intronic
991118734 5:62985728-62985750 ATGCAAAAGAAAAATTCTTAAGG + Intergenic
993250975 5:85521880-85521902 GTGCAAAGGGAAAACTATATGGG + Intergenic
993322587 5:86491368-86491390 GTACAAATGCAAAACAATAAAGG - Intergenic
993461966 5:88193278-88193300 ATACAAAACCAAGATTATAAGGG + Intronic
994447341 5:99894695-99894717 GTGCCTAAGCAATATAATAAAGG - Intergenic
994495926 5:100514125-100514147 GTGAAAATTCAAAATTATCATGG - Intergenic
994764789 5:103902327-103902349 GTGAAAAAGAAGAATAATAATGG + Intergenic
994954235 5:106506765-106506787 ATGCAAATGTAAAACTATAATGG + Intergenic
996257434 5:121422542-121422564 GTGCCAGAGCAAAATTATTAAGG + Intergenic
996555619 5:124776307-124776329 GTGCAGAAGCAAGATGATGATGG + Intergenic
996882078 5:128310648-128310670 TTCCAAAAGAAAAGTTATAATGG + Intronic
997047288 5:130332933-130332955 GTGCAACAGCAAAACTAGCACGG + Intergenic
997224769 5:132201159-132201181 GAGTAAAGGCAAAATTAAAAAGG + Intronic
997492307 5:134287746-134287768 TTTCAAAGGCAAAATTAGAAGGG - Intronic
997888644 5:137655425-137655447 ATGTAAAACAAAAATTATAAAGG + Intronic
998485700 5:142500000-142500022 AAGCAAAAGCAAAATTCCAAAGG - Intergenic
998728503 5:145046352-145046374 TGGGAAAAGCAAAATTTTAATGG - Intergenic
998903119 5:146877447-146877469 GTGCATTAGCAAAAATAAAAAGG - Intronic
999236221 5:150097470-150097492 GTTCAAAAGAAGAAATATAATGG + Intronic
1000855574 5:166394089-166394111 GAGAATAAGCAAAAGTATAAAGG - Intergenic
1000858872 5:166432822-166432844 TTTCAAAAGAAAAATTAAAATGG - Intergenic
1000925484 5:167188544-167188566 TTGCAAAAGCAACATAAAAAGGG - Intergenic
1001010541 5:168093837-168093859 GTGGCAAAGCTAAAATATAAAGG - Intronic
1001871329 5:175158488-175158510 GTGTAAAAACAGAATTATAATGG + Intergenic
1002830142 6:813086-813108 GTGTAAATGCATATTTATAATGG + Intergenic
1004991607 6:21144747-21144769 GTGCAAAGGCATAATGATCATGG - Intronic
1005286180 6:24329476-24329498 CTGCAATCCCAAAATTATAATGG + Intronic
1005910212 6:30302922-30302944 TTACAAAAGGAAATTTATAATGG + Intergenic
1006228529 6:32561748-32561770 GTGCAGAGGCAAAAATATATTGG - Intronic
1007139675 6:39558798-39558820 AAGCAAAAGCAAATTTAAAAAGG - Intronic
1007383675 6:41505901-41505923 GTGCAAAAGCACGTTTTTAAAGG - Intergenic
1009235327 6:61116419-61116441 ATACAAAAGCAAAAATATACTGG + Intergenic
1009351955 6:62691442-62691464 TTACTAAAGCAAAATTCTAAAGG + Intergenic
1009527730 6:64767487-64767509 ATGCAAAATAAAAATCATAAAGG - Intronic
1009664592 6:66658930-66658952 CTGTTAAAGCAAAATTAAAATGG + Intergenic
1010372941 6:75133104-75133126 GTGAAATAACAAATTTATAATGG - Intronic
1011439787 6:87375717-87375739 GTTCAAAATCATAATTATAAAGG - Intronic
1012118292 6:95332873-95332895 GTGAAAGAGGATAATTATAAAGG + Intergenic
1012198263 6:96372354-96372376 GTGAAAAAGGAAATTTAAAAAGG + Intergenic
1012558036 6:100540500-100540522 TTGAACAAGCAAAATTCTAAGGG - Intronic
1012844490 6:104372642-104372664 GAGGAAAAGGAAAATTATAGAGG + Intergenic
1012860902 6:104558034-104558056 ATGCACAAGCAAAAATAGAAAGG + Intergenic
1013276396 6:108589244-108589266 GTGCCCAGGAAAAATTATAAAGG - Intronic
1013879929 6:114885118-114885140 CTGCAAAACCAAAAATATGAGGG + Intergenic
1014572127 6:123022638-123022660 TTCCAAAATCAAAATTCTAATGG + Intronic
1015292651 6:131555565-131555587 AAGAAAAAGAAAAATTATAAGGG + Intergenic
1015383504 6:132596078-132596100 GTGAATAATCAAAAATATAAAGG + Intergenic
1015847210 6:137533193-137533215 ATGCAAAAGTAAAAATAAAATGG - Intergenic
1016260821 6:142167994-142168016 GTGTAAAATCACATTTATAAAGG + Intronic
1016446184 6:144134100-144134122 GTGCATTAGGAAAATTAAAATGG + Intergenic
1016527912 6:145023479-145023501 GACCAAGAGCAAAATAATAAAGG + Intergenic
1017549095 6:155485333-155485355 GTGTAAATGGAAAATTATAGAGG + Intergenic
1017759723 6:157558667-157558689 GTGGAAAAACAGAATCATAAGGG - Intronic
1017761108 6:157569515-157569537 TTGCAAAAGTAAAATAATAAGGG - Intronic
1018499527 6:164391070-164391092 TGGAAAAGGCAAAATTATAAGGG - Intergenic
1018557759 6:165065923-165065945 GAGCAGAAGCAAAACTTTAATGG + Intergenic
1021773157 7:24025306-24025328 GTACAAAAGCAAAACTATTCAGG - Intergenic
1022148500 7:27573080-27573102 CTGCAAAAGCAAACGCATAAAGG + Intronic
1022237565 7:28476915-28476937 GTGGAAAAGCAGAATTTTAATGG - Intronic
1022787831 7:33656470-33656492 GTGCAAAAGCAAGAGAATACAGG + Intergenic
1022836618 7:34122663-34122685 ATGCAAAACCAAAATTCTCAAGG - Intronic
1023300965 7:38770474-38770496 GTGCAGAAGCAAAATAATTTAGG - Intronic
1024848299 7:53677304-53677326 ATCCAAAAACTAAATTATAAGGG - Intergenic
1024986027 7:55193767-55193789 TTACAAAAGCAAAATTATTTGGG + Intronic
1025633212 7:63297333-63297355 ATGCAAAAAAAAAATTTTAATGG + Intergenic
1025649484 7:63450856-63450878 ATGCAAAAAAAAAATTTTAATGG - Intergenic
1028026472 7:85848028-85848050 GTGTAAAAGGAAAAATATATTGG - Intergenic
1028364899 7:90016514-90016536 GTTAAAAAGCAAAATTATCATGG - Intergenic
1028370706 7:90088591-90088613 ATGCAAAAGAAAAATTGTAAAGG + Intergenic
1028974739 7:96899846-96899868 GTGGAAAACCAAAGTTAAAATGG - Intergenic
1029882007 7:103823827-103823849 ATGTTAAAGCAAAATTTTAAAGG - Intronic
1030221626 7:107104740-107104762 ATTCAAAAGCAAAAGTATACTGG + Intronic
1030778018 7:113560897-113560919 GTGAAAAAACAAATTTATATTGG + Intergenic
1030878049 7:114840303-114840325 TTACAAAAGCAAAATTGTGAAGG - Intergenic
1030973782 7:116095078-116095100 TTGCAAAAGCATCATTAAAATGG + Intronic
1031126472 7:117779015-117779037 GAGAAAAAGCCACATTATAAAGG - Intronic
1031205714 7:118754972-118754994 GTGCAAAAGCAAACTTCTGCCGG + Intergenic
1031371481 7:120972764-120972786 GAGCAAAAGAAAAATGAGAAAGG + Intronic
1031445714 7:121851206-121851228 GTGTAAATAAAAAATTATAAAGG + Intergenic
1031910187 7:127508262-127508284 ATACAAAAATAAAATTATAAGGG + Intergenic
1033597197 7:142866453-142866475 GTGCAAAAGGAAAATTATTATGG - Intronic
1033610994 7:142962972-142962994 GTGTGAAAACAAAATTAAAATGG - Intergenic
1034230246 7:149519816-149519838 GTGCAAAAGTCAAATCAAAATGG + Intergenic
1034530308 7:151692388-151692410 TGGAAAAAGCAAAATTATAGCGG + Intronic
1037169020 8:15867589-15867611 GTGCGAAGTCACAATTATAAAGG + Intergenic
1037267643 8:17083606-17083628 CTGCCATTGCAAAATTATAATGG - Intronic
1037356375 8:18023993-18024015 TTGTTAAAGCAAAATTAAAATGG + Intronic
1037464102 8:19142308-19142330 GGAAAAAAGCAAAATTAAAATGG + Intergenic
1037927515 8:22855664-22855686 TATCAAAATCAAAATTATAAAGG + Intronic
1038552227 8:28480179-28480201 CTGAAAAAGGAAAATGATAAAGG - Intronic
1039027500 8:33273513-33273535 TTGTAAAAGCAAAATGAGAAAGG + Intergenic
1040276062 8:46014240-46014262 GTACAAAAGATAAATTTTAAAGG + Intergenic
1040345669 8:46490519-46490541 GAGCAGAAGAAAAATTAAAATGG - Intergenic
1040365033 8:46706448-46706470 CTGTATAACCAAAATTATAATGG - Intergenic
1041931065 8:63286963-63286985 CTGTAAAAAAAAAATTATAAAGG - Intergenic
1041949312 8:63483178-63483200 GTGGAAAAGCAACACTATTATGG - Intergenic
1041962564 8:63635834-63635856 GTGAAAAAGCCAAGTTATCAGGG + Intergenic
1042294451 8:67204200-67204222 GGACAAAAGCATAATTATAATGG - Intronic
1045001505 8:97882222-97882244 GTGAAAAAGACAAATAATAAGGG - Intronic
1045764032 8:105646129-105646151 GTTCAAAAAAAAAATAATAATGG + Intronic
1046194421 8:110840350-110840372 GCAAAAAAGCAAAATTATATGGG - Intergenic
1046460991 8:114535798-114535820 GTGAAAAAGAAAACTTCTAAGGG - Intergenic
1046817039 8:118596507-118596529 GTGGAAGAGCCAGATTATAATGG - Intronic
1048106684 8:131418647-131418669 GTGCAAAAGCAGCATCATAGAGG - Intergenic
1048249258 8:132846315-132846337 GGCCAAAAACAAAATTGTAAAGG + Exonic
1049498959 8:142951060-142951082 GGGCAAAAGAAAGAGTATAAAGG - Intergenic
1049598653 8:143497022-143497044 GTGCAAAAGCTCGTTTATAAAGG + Intronic
1050190232 9:3017339-3017361 GGTCAAAAGAAAAAATATAATGG - Intergenic
1051672539 9:19525928-19525950 GTTCAAAACCTAAATTATGAAGG - Intronic
1051751237 9:20343562-20343584 AGGCAAAAGCTAAGTTATAAGGG + Exonic
1052553799 9:29986696-29986718 GGGGAAAAGCAAAATTTTCAGGG - Intergenic
1052562047 9:30096936-30096958 CTGCAAAATCAAAAATAAAATGG + Intergenic
1052897344 9:33760077-33760099 GTGCTCAAGGAAAATAATAATGG - Intronic
1053522034 9:38790298-38790320 ATGCAAAAACAAAATTAGACGGG + Intergenic
1054885302 9:70191301-70191323 GTTCAAAAGCAAAAAAATCAGGG - Intronic
1055164198 9:73171627-73171649 GTGCAAAAGCAAGTTAACAAAGG - Intergenic
1055264975 9:74484887-74484909 ATTATAAAGCAAAATTATAAAGG + Intergenic
1055321951 9:75090942-75090964 GTGCAACAGGAACAATATAATGG - Intronic
1055872115 9:80893793-80893815 GTGCAAAGGAAAAAATACAAAGG - Intergenic
1056043388 9:82690684-82690706 GTGCAAAAGCAACATGATCCTGG + Intergenic
1056285612 9:85084736-85084758 GTGTAAGTGCAACATTATAAAGG + Intergenic
1058358592 9:104113454-104113476 ATGAAAAAGCTAAATTATGAAGG + Exonic
1059026705 9:110641792-110641814 AGGCAAAAACAAAATTAAAAAGG + Intergenic
1059350597 9:113662051-113662073 GTCCAAATGTATAATTATAAGGG + Intergenic
1059530578 9:115031690-115031712 GAGCAGAAGAAAAAGTATAATGG + Intronic
1059570879 9:115434220-115434242 ATGAAAAAGTAAAATTCTAAGGG - Intergenic
1060760678 9:126245643-126245665 GTGCAAAGAAAAAATTATTAAGG - Intergenic
1061732929 9:132630658-132630680 GTGGAGAAGTAAAATTAAAAAGG - Intronic
1203461128 Un_GL000220v1:39403-39425 GTGCAAAAACTAAATCAAAATGG - Intergenic
1187028178 X:15457470-15457492 AAGCACAAGCACAATTATAATGG - Intronic
1187352128 X:18529494-18529516 GAGAGAAAGCAAAATTATATAGG - Intronic
1187572937 X:20523673-20523695 CTGAAAAAGCAGAACTATAAGGG + Intergenic
1188240527 X:27782618-27782640 ATGCATTAGCATAATTATAAGGG - Intergenic
1188275946 X:28200351-28200373 GGACAAAAGTAAGATTATAATGG - Intergenic
1188348959 X:29103456-29103478 TTACAAAAGCAAAATCAAAATGG + Intronic
1188653609 X:32663304-32663326 ATTAAAAAGCAAAATAATAATGG - Intronic
1188869278 X:35353864-35353886 ATGCAAAAGAAATATCATAAAGG + Intergenic
1188954783 X:36421100-36421122 GTGGAAAAGCAAAATTTCTATGG - Intergenic
1189849232 X:45162527-45162549 GTGCAAACCCACAATTATATTGG + Intronic
1189907387 X:45775470-45775492 GTGTAAAAGGAAATTTTTAAAGG - Intergenic
1190192031 X:48285375-48285397 GTACGAAAGAAAAATAATAAAGG + Intergenic
1190447872 X:50548221-50548243 GTGGAAAAAGAAAATTATATAGG + Intergenic
1190656417 X:52616987-52617009 GTATAAAAGAAAAATAATAAAGG + Intergenic
1190682112 X:52835370-52835392 GTGAAAAAGCAAACTTTGAATGG - Intergenic
1190796858 X:53753724-53753746 GTACAAAAGTAAAATAAAAATGG - Intergenic
1190999038 X:55639504-55639526 GTGAAAAAGCAAACTTTGAATGG - Intergenic
1191140073 X:57107229-57107251 GTGCAAAGGCAAAAACATATTGG + Intergenic
1191972892 X:66837683-66837705 ATGCAAAAGCAAAATTAAAATGG + Intergenic
1192907210 X:75564123-75564145 ATGCAAAAAAAAAATGATAAAGG - Intergenic
1194368545 X:93039937-93039959 CAGCAAAAGCAGTATTATAAGGG - Intergenic
1194702087 X:97127081-97127103 GTTCAAAAACAATAGTATAATGG + Intronic
1194715479 X:97282714-97282736 GTCAAAAAGCAAAAATATAAAGG - Intronic
1194870218 X:99121598-99121620 GAGCAAAAGCAGAACTATCAGGG + Intergenic
1194883658 X:99286152-99286174 GTGCAACAGATAAATTTTAAAGG + Intergenic
1194904271 X:99554239-99554261 GTTCAAAAGAAAAAATATTATGG - Intergenic
1195041125 X:101015546-101015568 ATGAAAAGGCAATATTATAAAGG - Intronic
1197019993 X:121675344-121675366 GAACAAAAGCATAATTTTAAGGG + Intergenic
1197560973 X:128021223-128021245 GTGCAAAAGCAATTCTACAAGGG + Intergenic
1197742319 X:129904819-129904841 GGGCAAAAGCAAAATGGGAATGG + Intergenic
1198406721 X:136320560-136320582 TTACAAAAGCAGAAATATAAAGG - Intronic
1198429040 X:136547459-136547481 TTGCAAAAGCAGAATTCTGAGGG - Intronic
1199219762 X:145304696-145304718 ATGCAAAAGAAAAATCTTAAAGG - Intergenic
1200676746 Y:6156191-6156213 CAGCAAAAGCAGTATTATAAGGG - Intergenic
1201074076 Y:10173539-10173561 ATTCAAAAGCAAAAGTAGAAGGG + Intergenic
1201078128 Y:10201891-10201913 GTGCAAAATCGAATTTTTAAAGG - Intergenic
1201343215 Y:12955875-12955897 ATTCAAAAGCAAAAATATACTGG - Intergenic