ID: 1172826391

View in Genome Browser
Species Human (GRCh38)
Location 20:37790735-37790757
Sequence TAGCTATGAGGTCTGATGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 111}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172826391_1172826395 29 Left 1172826391 20:37790735-37790757 CCTGCCATCAGACCTCATAGCTA 0: 1
1: 0
2: 0
3: 9
4: 111
Right 1172826395 20:37790787-37790809 CATATTTAAAGTATACAATTTGG 0: 3
1: 24
2: 69
3: 210
4: 774

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172826391 Original CRISPR TAGCTATGAGGTCTGATGGC AGG (reversed) Intronic
908929705 1:69303960-69303982 TATCTGGGAGGACTGATGGCTGG - Intergenic
912297310 1:108482797-108482819 CAGCTCTGATGTCTGAGGGCAGG - Intergenic
913254459 1:116941302-116941324 TAGGGATGAGGGCTGATGGCTGG + Intronic
914263420 1:146018750-146018772 TATGTATGAGGTCTGATTGGGGG - Intronic
915895174 1:159806466-159806488 TGGCTAGGAGGTTTGGTGGCCGG + Intronic
916173083 1:162015917-162015939 CAGATATGAGGTCTGATGAGAGG - Intronic
916845397 1:168645069-168645091 TACCTCTGACGTCTGAGGGCAGG + Intergenic
917199687 1:172501416-172501438 TAGCTAAGAAGACTGATGGTGGG + Intergenic
918161515 1:181905249-181905271 AAGCTATGAAGTGTGAGGGCTGG - Intergenic
922204044 1:223431211-223431233 GAGCTCTGATGTCTGGTGGCAGG - Intergenic
922756729 1:228101124-228101146 AGGCTCTGAGGCCTGATGGCTGG - Exonic
924366270 1:243296865-243296887 GAGCAATGAGGACTGATGGCTGG - Intronic
1066164538 10:32772360-32772382 TAGCTGTGAGTTCTGATTACAGG - Intronic
1067216655 10:44309708-44309730 GAGCTCTGATGTCTGAGGGCAGG + Intergenic
1068018264 10:51545226-51545248 TATATATGAGGGCTGATTGCAGG - Intronic
1068120876 10:52780905-52780927 TGGCTCTGGGGTCTGCTGGCTGG + Intergenic
1068590995 10:58852979-58853001 TAGCTCTGTGGTCTCCTGGCTGG + Intergenic
1070641117 10:78170791-78170813 GAGGTCTGGGGTCTGATGGCAGG - Intergenic
1070720692 10:78754952-78754974 CAGCTCTGAGGGCTGCTGGCTGG - Intergenic
1071439418 10:85677260-85677282 TGGGTATGAGGGCTGCTGGCAGG + Intronic
1078661000 11:13285471-13285493 TAGCGATGAGGTATGGTGGGAGG + Intronic
1079448597 11:20579817-20579839 TAGCTGTGACGTCTAAGGGCAGG + Intergenic
1081152464 11:39648677-39648699 TAGCTATGAAGCCTGAGTGCTGG - Intergenic
1083229940 11:61310520-61310542 TAGCCAAGAACTCTGATGGCTGG + Intronic
1088400256 11:109415936-109415958 TAGGTCAGAGGTCTGATGGGTGG + Intergenic
1088659308 11:112029604-112029626 TAGAGATGGGGTCTGGTGGCAGG - Intronic
1090275689 11:125417763-125417785 TCGCTGTGAGGTCTGAAGACCGG - Intronic
1094758995 12:33507082-33507104 TATCTATGAGCTCTGATGTTGGG - Intergenic
1096021343 12:48328261-48328283 TAGATAAGAAGTCAGATGGCCGG + Intergenic
1097227162 12:57484393-57484415 TAACTAGGAGGTACGATGGCAGG + Intronic
1097426087 12:59446342-59446364 GAGCTGTGAGGTCTGCTGTCTGG + Intergenic
1100319759 12:93479399-93479421 TTGCTCTGACTTCTGATGGCAGG + Exonic
1101566321 12:105909301-105909323 TAGCTATGGGGTCAGGTGCCTGG + Intergenic
1101855872 12:108442280-108442302 AAGCTATGAGGCCTCAGGGCTGG - Intergenic
1103395166 12:120601591-120601613 TAGAGATGAGGTCTCAAGGCCGG + Intergenic
1103453786 12:121048933-121048955 GAGCTCTGATGTCTGATGGCAGG - Intergenic
1103571044 12:121845298-121845320 TAAAGATGAGGTCTTATGGCCGG + Intronic
1104651850 12:130540510-130540532 TATCTGGGAGGTCTGATGGTCGG - Intronic
1107394349 13:39999761-39999783 GAGCTGTGATGTCTGAGGGCAGG + Intergenic
1108287267 13:48920864-48920886 GAGCTATGATGTCTGAGGCCAGG - Intergenic
1110701501 13:78554031-78554053 TAGCCATGAGGGCAGATGGAAGG + Intergenic
1111178601 13:84632561-84632583 TAGCTATGAGGGCTCATATCTGG + Intergenic
1114861345 14:26527219-26527241 TAGCTGTGTGGTCTGAAGCCTGG + Intronic
1116585681 14:46700047-46700069 TAGCTGGGAGGCCTGATGGTAGG - Intergenic
1126906034 15:53366735-53366757 TTGCCATGAGGTCTGGTGGGAGG + Intergenic
1130788620 15:87127484-87127506 TAACTATGATGACTGATAGCTGG + Intergenic
1132203509 15:99970995-99971017 AAGCTGTGAGGGCTGTTGGCAGG + Intergenic
1137917192 16:52444992-52445014 TTCCTAAGTGGTCTGATGGCTGG + Intronic
1138157560 16:54720391-54720413 CAGCTCTGGGGGCTGATGGCAGG - Intergenic
1142767158 17:2071390-2071412 TACCTGTGTGTTCTGATGGCAGG + Intronic
1146443273 17:32915706-32915728 TAGGTAAGAGGTATGATTGCTGG - Intergenic
1148970729 17:51478937-51478959 TCCCTTTGAGGTCTAATGGCAGG - Intergenic
1152006537 17:77685734-77685756 GATTTATGAGGTCTGATGACAGG + Intergenic
1155601742 18:27556811-27556833 TAGTAATGATGTCTGATGGTTGG + Intergenic
1156162231 18:34373389-34373411 TAGCTATCACCTCTGATGGAAGG - Intergenic
1156453793 18:37281544-37281566 TGGCTTTGAGGTCTAGTGGCTGG + Intronic
1166756621 19:45196418-45196440 GAGCTAGGAGGTCTGAGGTCAGG + Intronic
1166993544 19:46707644-46707666 TGGCTATGAGGACAGATGACAGG - Intronic
927819845 2:26254426-26254448 CAGCTCAGAGGTCTTATGGCTGG - Exonic
928346361 2:30500897-30500919 TATCTGTGAGGCCTGATGGTTGG - Intronic
928437834 2:31267169-31267191 GAGCTAGGAGATCTGAGGGCAGG + Exonic
930154690 2:48094040-48094062 TAGCTAATAAGTCTGATGGTTGG - Intergenic
930430406 2:51268249-51268271 GAGCTCTGATGTCTGAGGGCAGG + Intergenic
931978988 2:67674327-67674349 TAGCTATGGGACCAGATGGCAGG + Intergenic
934135362 2:88991346-88991368 TATCTACGAGGCCTGATGGTTGG - Intergenic
935525206 2:104157207-104157229 GAGCTCTGATGTCTGAAGGCAGG + Intergenic
938206671 2:129430077-129430099 TAGTTGTGATGTCTGATGCCCGG - Intergenic
943173180 2:184431358-184431380 TAGCAAAGAGGTCTGAGGTCTGG + Intergenic
948181217 2:235982424-235982446 TAGCTAGGAGGTCAGAAGGAAGG + Intronic
948616122 2:239200208-239200230 TAGCTCTGAGGAGGGATGGCAGG - Intronic
1169677022 20:8165877-8165899 GTGCTATTAGGTCTGGTGGCAGG - Intronic
1172826391 20:37790735-37790757 TAGCTATGAGGTCTGATGGCAGG - Intronic
1174712414 20:52720958-52720980 GAGCTCTGATGTCTGAGGGCAGG + Intergenic
1181634976 22:24170285-24170307 GAGCTATGGGCTCTGATGGCAGG - Intronic
1183904342 22:41028924-41028946 TAGCTTTGAGCTCTGATGAAAGG + Intergenic
1184380545 22:44142625-44142647 GAGCTTTAGGGTCTGATGGCTGG + Intronic
953133568 3:40163617-40163639 AAGCTCTGATGTCTGAGGGCAGG - Intronic
953391059 3:42533991-42534013 CAGCTATGAGGTCAGGTGGCTGG + Intronic
955213212 3:56961541-56961563 TGGCTATGAGGCCTGATGGTGGG - Intronic
959447029 3:106453112-106453134 CAGCTCTGATGTCTGAGGGCAGG + Intergenic
960636611 3:119791113-119791135 AAGTTATAAGGTCTGCTGGCTGG - Intronic
964416845 3:156456846-156456868 GAGCTTTGAGGTCTGTTTGCAGG + Intronic
965281184 3:166754944-166754966 TAGCAATGAGGTTTGAAGGGAGG - Intergenic
965935621 3:174106798-174106820 GAGCTGTGATGTCTGAGGGCAGG + Intronic
966167155 3:177033022-177033044 TAGCTTTCAGTCCTGATGGCAGG - Exonic
967226807 3:187299720-187299742 GAGCTCTGATGTCTGACGGCAGG - Intergenic
971928742 4:33050141-33050163 GAGCTATGATGTCTTAGGGCAGG - Intergenic
987444653 5:18002647-18002669 TAGCTATGAGGTGTGAAAGAGGG + Intergenic
987449656 5:18066301-18066323 TATCTATGAGGTGTCATGGTAGG + Intergenic
987580992 5:19792295-19792317 GAGCTCTGAGGTCGGAGGGCAGG - Intronic
988493784 5:31727408-31727430 TTGCTATAAGGTCACATGGCCGG + Intronic
992094254 5:73346353-73346375 GAGTTCTGATGTCTGATGGCAGG + Intergenic
992366980 5:76102313-76102335 TAGCTATGTGATCTGGTGGGTGG - Intronic
993443825 5:87988391-87988413 GAGCTCTGATGTCTGAGGGCAGG - Intergenic
999777233 5:154821130-154821152 TGGGGAAGAGGTCTGATGGCTGG - Intronic
1002023232 5:176379090-176379112 TAGCTATGGGGTCTAATTGCAGG + Exonic
1006235812 6:32630958-32630980 TAGGTATGAGGTCTTATTTCTGG + Intronic
1007509954 6:42367219-42367241 GAGCTGTGAGGTCTGAAGGCTGG - Intronic
1009314135 6:62196685-62196707 TAGCAATGAGGTCTGCTCACAGG + Intronic
1009968341 6:70601303-70601325 GAGCTCTGATGTCTGAGGGCAGG - Intergenic
1013068403 6:106705587-106705609 TATCTGGGAGGCCTGATGGCTGG + Intergenic
1013755054 6:113451805-113451827 TATCTGGGAGGTCTGATGGTTGG - Intergenic
1014959074 6:127659869-127659891 TAGCTTTCAGTCCTGATGGCCGG - Intergenic
1016234355 6:141844824-141844846 TATGTCTGAGGTCTCATGGCTGG + Intergenic
1023389573 7:39696343-39696365 TAGTTTTGAGGACTGCTGGCTGG - Intronic
1023865220 7:44235182-44235204 AAGGTATGAGGTCTGAGAGCAGG - Intronic
1024712708 7:52035218-52035240 GAGCTCTGATGTCTGAGGGCAGG - Intergenic
1024864494 7:53889010-53889032 TATCTAGGAGGCCTGATGGTTGG + Intergenic
1024872637 7:53983789-53983811 TTGCTATGAGCTCCCATGGCAGG - Intergenic
1031630861 7:124041257-124041279 TGGCAGTGAGGTGTGATGGCAGG + Intergenic
1039216536 8:35278144-35278166 TAGCACTGAGTTCTGATGTCTGG + Intronic
1039944385 8:42117248-42117270 TGGCTATGGGGACTGTTGGCGGG - Intergenic
1046077760 8:109333629-109333651 GAGGTCTGAGGTCTGAGGGCTGG - Intronic
1046636094 8:116677920-116677942 TACCTAACAGGTCTGATGACAGG + Intronic
1047462632 8:125082102-125082124 TAGGTATCAGGACAGATGGCTGG + Intronic
1188456724 X:30374798-30374820 TAGCTATGAGCTCTTTGGGCAGG + Intergenic
1193466033 X:81848863-81848885 TAGCTATAATGCCTGATGGCAGG + Intergenic
1196226413 X:113172636-113172658 AAGTTCTGATGTCTGATGGCAGG - Intergenic
1196937657 X:120745557-120745579 TAGCTCACAGTTCTGATGGCGGG + Intergenic
1197069316 X:122275630-122275652 TCACTATGAGATCTGATGGTTGG + Intergenic
1201343704 Y:12960032-12960054 TAGTTAGGAGGTCTGAGGTCTGG - Intergenic